Register
Filter

Recent questions

0 votes
0 answers
482
GATE2017-24
A bacterium has a genome of size $6$ million base pairs. If the average rate of DNA synthesis is $1000$ base pairs/second, the time taken (in minutes) for replication of the genome will be ________.
A bacterium has a genome of size $6$ million base pairs. If the average rate of DNA synthesis is $1000$ base pairs/second, the time taken (in minutes) for replication of ...
0 votes
0 answers
483
GATE2017-25
At the transcription start site of a gene, any of the four nucleotides can occur with equal probability $p$. The Shannon Entropy $S$, given by $S= – \Sigma_{i=1}^4 p_i \ln p_i$, for this start site is _________
At the transcription start site of a gene, any of the four nucleotides can occur with equal probability $p$. The Shannon Entropy $S$, given by $S= – \Sigma_{i=1}^4 p_i ...
0 votes
0 answers
484
GATE2017-26
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentration of free protein in solution
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...
0 votes
0 answers
486
GATE2017-28
The angle (in degrees) between the vectors $\overrightarrow{x}= \hat{i}-\hat{j}+2 \hat{k}$ and $\overrightarrow{y} = 2 \hat{i} – \hat{j}-1.5 \hat{k}$ is _________
The angle (in degrees) between the vectors $\overrightarrow{x}= \hat{i}-\hat{j}+2 \hat{k}$ and $\overrightarrow{y} = 2 \hat{i} – \hat{j}-1.5 \hat{k}$ is _________
0 votes
0 answers
487
GATE2017-29
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$ ... $\text{P-,2 Q-3, R-1, S-4}$ $\text{P-4, Q-3, R-1, S-2}$ $\text{P-2, Q-3, R-4, S-1}$
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...
0 votes
0 answers
488
GATE2017-30
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below: Choose the correct combination. $P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{ and } R: \text{Random coil}$ ... $P: \beta- \text{Random coil}, Q: \alpha- \text{helix}, \text{ and }R: \text{sheet}$
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below:Choose the correct combination.$P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{...
0 votes
0 answers
489
GATE2017-31
Match the organisms in $\text{Column I}$ with the characteristics in $\text{Column II}$ ... $\text{P-2, Q-1, R-4, S-3}$ $\text{P-4, Q-1, R-2, S-3}$
Match the organisms in $\text{Column I}$ with the characteristics in $\text{Column II}$:$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \textbf{Column II} \\ \hli...
0 votes
0 answers
490
GATE2017-32
Which one of the following amino acids has three ionizable groups? Glycine Leucine Valine Lysine
Which one of the following amino acids has three ionizable groups?GlycineLeucineValineLysine
0 votes
0 answers
492
GATE2017-34
The concentration (in micromolar) of NADH in a solution with $A_{340}=0.50$ is _________ Given data: Path length $=1$ cm; Molar extinction coefficient of NADH $\varepsilon_{340}= 6220 M^{-1}cm^{-1}$
The concentration (in micromolar) of NADH in a solution with $A_{340}=0.50$ is _________Given data: Path length $=1$ cm; Molar extinction coefficient of NADH $\varepsilon...
0 votes
0 answers
493
GATE2017-35
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ion-exchange chromatography. The fold purification is ________
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ...
0 votes
0 answers
494
GATE2017-36
Which one of the following organisms is responsible for crown gall disease in plants? $\textit{Xanthomonas campestris}$ $\textit{Rhizobium etli}$ $\textit{Agrobacterium tume faciens}$ $\textit{Erwinia stewartii}$
Which one of the following organisms is responsible for crown gall disease in plants?$\textit{Xanthomonas campestris}$$\textit{Rhizobium etli}$$\textit{Agrobacterium tume...
0 votes
0 answers
495
GATE2017-37
The value of $c$ for which the following system of linear equations has an infinite number of solutions is ________ $\begin{bmatrix}1 & 2 \\ 1 & 2 \end{bmatrix} \begin{bmatrix} x \\ y \end{bmatrix} = \begin{bmatrix} c \\ 4 \end{bmatrix}$
The value of $c$ for which the following system of linear equations has an infinite number of solutions is ________ $$\begin{bmatrix}1 & 2 \\ 1 & 2 \end{bmatrix} \begin{b...
0 votes
0 answers
496
GATE2017-38
Match the plant hormones in $\textbf{Column I}$ with functions in $\textbf{Column II}$ ... $\text{P-3, Q-1, R-2, S-4}$ $\text{P-2, Q-1, R-4, S-3}$
Match the plant hormones in $\textbf{Column I}$ with functions in $\textbf{Column II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \text{Column II} \\ \hline ...
0 votes
0 answers
498
GATE2017-40
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over time?
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...
0 votes
0 answers
499
GATE2017-41
The genome is diploid at the end of which phases of a human mitotic cell cycle? $\text{G2 & S}$ $\text{G1 & M}$ $\text{M & S}$ $\text{G1 & G2}$
The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$
0 votes
0 answers
502
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
503
GATE2017-45
A pedigree of an inheritable disease is shown below. This inheritable disease is $X$-linked dominant $X$-linked recessive or Y-linked only $Y$-linked only $X$-linked recessive
A pedigree of an inheritable disease is shown below.This inheritable disease is$X$-linked dominant$X$-linked recessive or Y-linkedonly $Y$-linkedonly $X$-linked recessive...
0 votes
0 answers
504
GATE2017-46
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________ Given data: Atomic weights $(Da)$ of $C=12, H=1, O=16, N=14$, and $S=32$.
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________Given data: Atomic ...
0 votes
0 answers
505
GATE2017-47
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
0 votes
0 answers
507
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
508
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
509
GATE2017-51
EcoRI restriction sites on a $10$ kb DNA fragment are shown below. Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained? $2,3,4,5,6,7,8$, and $10$ $2,3,4,5,6,$ and $7$ $2,3,4,$ and $7$ $2$ and $3$
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...
0 votes
0 answers
510
GATE2017-52
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______ Given data: $\pi = 3.14$
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______Given da...
0 votes
0 answers
512
GATE2017-54
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$ ... , the ethanol produced (in grams) is ________ Given data: Atomic weights (Da) of $C=12, H=1, O=16$, and $N=14$
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$. Every mole of carbon present in glu...
0 votes
0 answers
513
GATE2017-55
Which of the following conditions promote the development of human autoimmune disorders? Inability to eliminate self-reactive lymphocytes Generation of auto-antibodies Ability to eliminate self-reactive T-cells Induction of regulatory T-cells in the thymus P,R Q,S P,Q R,S
Which of the following conditions promote the development of human autoimmune disorders?Inability to eliminate self-reactive lymphocytesGeneration of auto-antibodiesAbili...
0 votes
0 answers
514
GATE2017-56
She has a sharp tongue and it can occasionally turn ___________ hurtful left methodical Vital
She has a sharp tongue and it can occasionally turn ___________hurtfulleftmethodicalVital
0 votes
0 answers
515
GATE2017-57
I ________ made arrangements had I _________ informed earlier. could have, been would have, being had, have had been, been
I ________ made arrangements had I _________ informed earlier.could have, been would have, beinghad, havehad been, been
0 votes
0 answers
517
GATE2017-59
$40\%$ of deaths on city roads may be attributed to drunken driving. The number of degrees needed to represent this as a slice of a pie chart is $120$ $144$ $160$ $212$
$40\%$ of deaths on city roads may be attributed to drunken driving. The number of degrees needed to represent this as a slice of a pie chart is$120$$144$$160$$212$
Page: