search
Log In
Welcome to GATE BioTechnology, where you can ask questions and receive answers from other members of the community.
0 votes

Which one of the following DNA sequences carries an invert repeat?

  1. ATGAGCCCCGAGTATACTCGGGGCTCAT
  2. ATGAGCCGGCTCTATACTCGGCCGAGAT
  3. ATGAGCCGAGCCTAACTCGGCTCGGAT
  4. ATGAGCCTATGGTATACTCGGATACCAT
in Others 7.9k points
edited by

Please log in or register to answer this question.

...