Bio Technology
0 votes
image

Q26 Which one of the following DNA sequences carries an invert repeat?

  1. ATGAGCCCCGAGTA
  2. ATGAGCCGGCTCTATACTCGGGGCTCAT TACTCGGCCGAGAT
  3. ATGAGCCGAGCCTA
  4. ATGAGCCTATGGTAACTCGGCTCGGAT TACTCGGATAC CAT
in Others by (7.9k points)

Please log in or register to answer this question.

Welcome to GATE BioTechnology, where you can ask questions and receive answers from other members of the community.
455 questions
2 answers
0 comments
966 users