Register

Recent questions tagged gate2017

0 votes
0 answers
41
GATE2017-35
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ion-exchange chromatography. The fold purification is ________
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ...
0 votes
0 answers
44
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
45
GATE2017-45
A pedigree of an inheritable disease is shown below. This inheritable disease is $X$-linked dominant $X$-linked recessive or Y-linked only $Y$-linked only $X$-linked recessive
A pedigree of an inheritable disease is shown below.This inheritable disease is$X$-linked dominant$X$-linked recessive or Y-linkedonly $Y$-linkedonly $X$-linked recessive...
0 votes
0 answers
46
GATE2017-46
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________ Given data: Atomic weights $(Da)$ of $C=12, H=1, O=16, N=14$, and $S=32$.
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________Given data: Atomic ...
0 votes
0 answers
47
GATE2017-47
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
0 votes
0 answers
49
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
50
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
51
GATE2017-51
EcoRI restriction sites on a $10$ kb DNA fragment are shown below. Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained? $2,3,4,5,6,7,8$, and $10$ $2,3,4,5,6,$ and $7$ $2,3,4,$ and $7$ $2$ and $3$
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...
0 votes
0 answers
52
GATE2017-52
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______ Given data: $\pi = 3.14$
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______Given da...
0 votes
0 answers
54
GATE2017-54
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$ ... , the ethanol produced (in grams) is ________ Given data: Atomic weights (Da) of $C=12, H=1, O=16$, and $N=14$
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$. Every mole of carbon present in glu...
0 votes
0 answers
55
GATE2017-55
Which of the following conditions promote the development of human autoimmune disorders? Inability to eliminate self-reactive lymphocytes Generation of auto-antibodies Ability to eliminate self-reactive T-cells Induction of regulatory T-cells in the thymus P,R Q,S P,Q R,S
Which of the following conditions promote the development of human autoimmune disorders?Inability to eliminate self-reactive lymphocytesGeneration of auto-antibodiesAbili...
0 votes
0 answers
56
GATE2017-56
She has a sharp tongue and it can occasionally turn ___________ hurtful left methodical Vital
She has a sharp tongue and it can occasionally turn ___________hurtfulleftmethodicalVital
0 votes
0 answers
57
GATE2017-57
I ________ made arrangements had I _________ informed earlier. could have, been would have, being had, have had been, been
I ________ made arrangements had I _________ informed earlier.could have, been would have, beinghad, havehad been, been
0 votes
0 answers
59
GATE2017-59
$40\%$ of deaths on city roads may be attributed to drunken driving. The number of degrees needed to represent this as a slice of a pie chart is $120$ $144$ $160$ $212$
$40\%$ of deaths on city roads may be attributed to drunken driving. The number of degrees needed to represent this as a slice of a pie chart is$120$$144$$160$$212$
0 votes
0 answers
64
GATE2017-64
There are $3$ Indians and $3$ Chinese in a group of $6$ people. How many subgroups of this group can we choose so that every subgroup has at least one Indian? $56$ $52$ $48$ $44$
There are $3$ Indians and $3$ Chinese in a group of $6$ people. How many subgroups of this group can we choose so that every subgroup has at least one Indian?$56$$52$$48$...
Page: