Register

GATE BT 2024 | Question: 40

• edited by
0 votes
0 votes

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?

$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$

  1. It contains nine codons in the reading frame
  2. It contains ten codons in the reading frame
  3. It codes for eight amino acids
  4. It codes for nine amino acids
• edited by

Please log in or register to answer this question.

Voting & Accepting an answer helps improve the community

Related questions

0 votes
0 votes
0 answers
1
admin asked Mar 25
GATE BT 2024 | Question: 1
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$. covalent bonds electrostatic interactions ionic bonds van der Waals forces
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$.covalent bondselectrostatic interac...
0 votes
0 votes
0 answers
2
admin asked Mar 25
GATE BT 2024 | Question: 2
The transfer function of a process is $G(s)=\frac{K_{p}}{\tau_{p} s+1}$, where $K_{p}$ is the gain and $\tau_{p}$ is the time constant. This is a $\_\_\_\_\_\_$ process. first order multi-capacity purely capacity second order
The transfer function of a process is $G(s)=\frac{K_{p}}{\tau_{p} s+1}$, where $K_{p}$ is the gain and $\tau_{p}$ is the time constant. This is a $\_\_\_\_\_\_$ process.f...
0 votes
0 votes
0 answers
5
admin asked Mar 25
GATE BT 2024 | Question: 5
The relationship that involves the exchange of nutrients between two different species for their mutual growth is called $\_\_\_\_\_\_\_\_$ antagonism commensalism parasitism syntrophism
The relationship that involves the exchange of nutrients between two different species for their mutual growth is called $\_\_\_\_\_\_\_\_$antagonismcommensalismparasitis...
Link Copied!