Register
Filter

Most answered questions in Others

0 votes
0 answers
41
GATE BT 2024 | Question: 25
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will be $\_\_\_\_\_\_\_$ min (rounded off to $1$ decimal place).
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will ...
0 votes
0 answers
49
GATE BT 2024 | Question: 33
The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution. convergent divergent neutral parallel
The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution.convergentdivergentneutralparallel
0 votes
0 answers
53
GATE BT 2024 | Question: 37
Which of the following is/are considered as biotic elicitor(s) in plant cell culture? Cellulase Chitin Chitosan Mercuric chloride
Which of the following is/are considered as biotic elicitor(s) in plant cell culture?CellulaseChitinChitosanMercuric chloride
0 votes
0 answers
54
GATE BT 2024 | Question: 38
Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle? Initiation of cell plate formation Incomplete DNA replication Chiasmata formation Irreparable DNA damage
Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle?Initiation of cell plate formationIncomplete DNA replicationC...
0 votes
0 answers
55
GATE BT 2024 | Question: 39
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally? $2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acid Indole-$3$-butyric acid $1$-Naphthaleneacetic acid
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...
0 votes
0 answers
56
GATE BT 2024 | Question: 40
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE? $5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$ It contains nine codons in the reading frame It contains ten codons in the reading frame It codes for eight amino acids It codes for nine amino acids
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...
0 votes
0 answers
57
GATE BT 2024 | Question: 41
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon? Absence of glucose Absence of lactose Presence of glucose Presence of lactose
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...
0 votes
0 answers
58
GATE BT 2024 | Question: 42
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process? $\mathrm{pH}$ of the medium Osmolarity of the medium Substrate concentration in the medium Substrate feed rate
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...
0 votes
0 answers
61
GATE BT 2024 | Question: 45
Aspergillus niger is grown in a $10,000$ ... concentration is $\_\_\_\_\_\_\_$ $\mathrm{kg} \mathrm{m}^{-3}$ (Answer in integer).
Aspergillus niger is grown in a $10,000$ L stirred batch bioreactor under aerated conditions to produce citric acid. At steady state oxygen transfer conditions, the speci...
0 votes
0 answers
67
GATE BT 2024 | Question: 51
Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ ... is constant shear. The impeller speed in the prototype reactor will be $\_\_\_\_\_\_\_$ rm (Answer in integer).
Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ prototype stirred tank reactor. The model-type and prototype have the ...
0 votes
0 answers
68
GATE BT 2024 | Question: 52
If $\vec{v}=\left(\begin{array}{l}2 \\ 2 \\ 2\end{array}\right)$ is an eigenvector of the matrix $\left(\begin{array}{lll}1 & 2 & 3 \\ 1 & 2 & 3 \\ 1 & 2 & 3\end{array}\right)$ corresponding to the non-zero eigenvalue, $\lambda$, then the value of $\lambda$ is $\_\_\_\_\_\_\_\_$.
If $\vec{v}=\left(\begin{array}{l}2 \\ 2 \\ 2\end{array}\right)$ is an eigenvector of the matrix $\left(\begin{array}{lll}1 & 2 & 3 \\ 1 & 2 & 3 \\ 1 & 2 & 3\end{array}\r...
0 votes
0 answers
69
GATE BT 2024 | Question: 53
The value of the limit $\lim _{x \rightarrow \infty} \frac{x}{2} \ln \left(1+\frac{2024}{x}\right)$ is $\_\_\_\_\_\_\_\_$.
The value of the limit $\lim _{x \rightarrow \infty} \frac{x}{2} \ln \left(1+\frac{2024}{x}\right)$ is $\_\_\_\_\_\_\_\_$.
0 votes
0 answers
70
GATE BT 2024 | Question: 54
Let $y(x)=x^2 \ln x$ for $x>0$, be a solution of $x^2 \frac{d^2 y}{d x^2}+4 y=\alpha x \frac{d y}{d x}$. Then the value of $\alpha$ is $\_\_\_\_\_\_\_\_\_$.
Let $y(x)=x^2 \ln x$ for $x>0$, be a solution of $x^2 \frac{d^2 y}{d x^2}+4 y=\alpha x \frac{d y}{d x}$. Then the value of $\alpha$ is $\_\_\_\_\_\_\_\_\_$.
0 votes
0 answers
71
GATE BT 2024 | Question: 55
The absolute relative error in evaluating the integral $\int_0^1 x^2 d x$ by the trapezoidal rule with the step size $0.25$ is $\%$ $\_\_\_\_\_\_\_\_$ (rounded off to $2$ decimal places).
The absolute relative error in evaluating the integral $\int_0^1 x^2 d x$ by the trapezoidal rule with the step size $0.25$ is $\%$ $\_\_\_\_\_\_\_\_$ (rounded off to $2$...
0 votes
0 answers
73
GATE BT 2024 | GA Question: 2
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$ depends on $x y$ depends only on $x$ and not on $y$ depends only on $y$ and not on $x$ is a constant
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$depends on $x y$depends only on $x$ an...
0 votes
0 answers
74
GATE BT 2024 | GA Question: 3
Consider the following sample of numbers: \[ 9,18,11,14,15,17,10,69,11,13 \] The median of the sample is $13.5$ $14$ $11$ $18.7$
Consider the following sample of numbers:\[9,18,11,14,15,17,10,69,11,13\]The median of the sample is$13.5$$14$$11$$18.7$
0 votes
0 answers
75
GATE BT 2024 | GA Question: 4
The number of coins of ₹ $1$, ₹ $5$, and ₹ $10$ denominations that a person has are in the ratio $5: 3: 13$. Of the total amount, the percentage of money in ₹ $5$ coins is $21 \%$ $14 \frac{2}{7} \%$ $10 \%$ $30 \%$
The number of coins of ₹ $1$, ₹ $5$, and ₹ $10$ denominations that a person has are in the ratio $5: 3: 13$. Of the total amount, the percentage of money in ₹ $5$...
0 votes
0 answers
76
GATE BT 2024 | GA Question: 5
For positive non-zero real variables $p$ and $q$, if \[ \log \left(p^{2}+q^{2}\right)=\log p+\log q+2 \log 3, \] then, the value of $\frac{p^{4}+q^{4}}{p^{2} q^{2}}$ is $79$ $81$ $9$ $83$
For positive non-zero real variables $p$ and $q$, if\[\log \left(p^{2}+q^{2}\right)=\log p+\log q+2 \log 3,\]then, the value of $\frac{p^{4}+q^{4}}{p^{2} q^{2}}$ is$79$$8...
0 votes
0 answers
80
GATE BT 2024 | GA Question: 9
A rectangular paper of $20 \mathrm{~cm} \times 8 \mathrm{~cm}$ is folded $3$ times. Each fold is made along the line of symmetry, which is perpendicular to its long edge. The perimeter of the final folded sheet (in $\mathrm{cm})$ is $18$ $24$ $20$ $21$
A rectangular paper of $20 \mathrm{~cm} \times 8 \mathrm{~cm}$ is folded $3$ times. Each fold is made along the line of symmetry, which is perpendicular to its long edge....
Page: