Recent questions and answers in Molecular Biology and Genetics:

In nitrogen fixation, to reduce nitrogen to ammonia, which one of the following shows the correct order of electron flow?Ferredoxin → reductase → nitrogenaseNADH → reduct...

For monoclonal antibody production, hypoxanthine $\_\_\_\_$.allows DNA synthesis in the absence of de novo dTMP synthesisallows purine synthesis in cells containing HGPRT...

Which one of the following antibiotics blocks protein chain elongation by preventing the action of peptidyl transferase?BleomycinRifampicinChloramphenicolTetracycline

The RNA primer synthesized during bacterial DNA replication is removed by $\_\_\_\_$.DNA gyraseDNA Polymerase $\text{I}$PrimaseDNA Polymerase $\text{III}$

Match the biomolecules in Column $\text{I}$ with their function given in Column $\text{II}$\[\begin{array}{|l|l|}\hline\text{Column I} & \text{Column II} \\\hline\text{P....

Messenger $\text{RNAs (mRNAs)}$ translate to generate polypeptides and the translation terminates at the $\text{UGA, UAG}$ or $\text{UAA}$ stop codons. The $\text{AGA}$ c...

The RNA sequence below depicts the part of a $330$ nucleotides long $\text{mRNA}$ and it encodes the $\text{C}$-terminal portion of a protein.$5^{\prime}-\ldots \ldots$ $...

Which of the following is/are posttranslational modification(s) involved in epigenetic control of gene expression?Arginine methylationLysine acetylationCytosine methylati...

​​​​Which one of the following is true for piRNAs?piRNAs silence transposable elements in germ cellspiRNA is the abbreviation of $P$-element interacting RNApiRNAs modify ...

​​​​Which of the following enzymes is/are involved in the biogenesis of miRNA?DroshaCas$9$XRCC$4$Dicer

The contour length of a B-DNA molecule that encodes a bacterial protein of $33 \: \text{kDa}$ is $\_\_\_\_$ $\mathrm{ nm}$.Consider the average molecular weight of an ami...

​​​​​An octapeptide composed of these $L$-amino acids - Lys, Thr, Ser, Met, Arg, Trp, Tyr, Glu - was subjected to analyses with the following outcomes:$\text{P}$. The N-t...

Correctly match the Enzyme with its respective Function.\begin{array}{|l|l|}\hline \textbf{ Enzyme } & \textbf{ Function } \\\hline \text{P. Gyrase} & 1. \text{Removes a ...

​​​​Which of the following statements about initiation of DNA replication in eukaryotes is/are true?DNA replication is initiated at the origin of replication licensed by ...

​​​​Which of the following proteins is/are involved in intraflagellar transport?MicrotubulesMyosinActinKinesin

​​​​Which of the following statements is/are true about telomerase?Telomerase has $5^{\prime}-3^{\prime}$ DNA-dependent DNA polymerisation activityTelomerase has $5^{\pri...

Co-translational translocation of proteins is observed in $\_\_\_\_\_\_\_$.endoplasmic reticulumGolgi complexmitochondriaperoxisomes

A cultured skin fibroblast cell of a goat ' $\mathrm{P}$ ' was fused with an enucleated ovum of a goat ' $\mathrm{Q}$ '. The resultant activated early embryo was then tra...

An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$carbonnitrogenoxygenphosphorous

If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein.primarysecondarytertiary...

All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$.protein with original functionprotein with altered functionRNA with coding sequenceRNA with regulatory function

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...

Determine the correctness or otherwise of the following Assertion $[\text{a}]$ and the Reason $[\mathrm{r}]$.Assertion $[\mathrm{a}]$: In multicellular organisms, cells o...

C-value paradox refers tothe lack of correlation between genome size and genetic complexity of an organismthe presence of genetic sequences that propagate themselves with...

Intracellular proteins are targeted for proteolytic degradation in proteasomes upon conjugation with ubiquitinintegrinpeptidasecalreticulin

Match the types of RNA in Group I with their corresponding function in Group II.Group IGroup IIP. mRNA1. Serves as adaptors between mRNA and amino acids during protein sy...

The event(s) that lead(s) to inactivation of tumor suppressor genes in cancer cells is(are)gene amplificationpromoter methylationloss of heterozygosityhistone acetylation

Methylation of $\mathrm{CpG}$ islands near the promoter of a gene can inhibit transcription bypreventing RNA polymerase bindingfacilitating repressor bindingfacilitating ...

Which of the following statement(s) is(are) TRUE about induced pluripotent stem cells?They can self-renewThey require specific signals to maintain their stemnessThey cann...

DNA sample collected from an unidentified bacterial species $(Y)$ contains $13 \%$ of adenine. The $G+C$ content (in percentage) of $Y$ is ____________.

The type of nucleic acid present in $\lambda$-phage isDouble stranded $\text{DNA}$Single stranded circular $\text{DNA}$Single stranded $\text{DNA}$Single stranded $\text{...

In animal cells, the endogenously produced $\text{miRNAs}$ silence gene expression bybase pairing with the $3’$-untranslated region of specific $\text{mRNAs}$blocking $\t...

Which of the following are CORRECT about protein structure?Secondary structure is formed by a repeating pattern of interactions among the polypeptide backbone atomsTertia...

The enzymes involved in ubiquitinylation of cell-cycle proteins are$\text{E}_{1}$ and $\text{E}_{2}$ Only$\text{E}_{1}$ and $\text{E}_{3}$ Only$\text{E}_{1}$ and $\text{E...

Adenine can undergo a spontaneous change to hypoxanthine in a cell, leading to a $\text{DNA}$ base pair mismatch. The $\text{CORRECT}$ combination of enzymes that are inv...