Most answered questions / GO BioTechnology

0 votes

0 answers

41

GATE BT 2024 | Question: 13
Which one of the following is the basic principle of Sanger's DNA sequencing method? Chain termination by incorporation of dideoxynucleotides Chain elongation by incorporation of dideoxynucleotides Release of inorganic pyrophosphate Chain cleavage by modification of dideoxynucleotides

Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

42

GATE BT 2024 | Question: 14
An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$ carbon nitrogen oxygen phosphorous

An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$carbonnitrogenoxygenphosphorous

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

43

GATE BT 2024 | Question: 15
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway. only an anabolic only a catabolic an amphibolic a pyogenic

Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway.only an anaboliconly a catabolic an amphibolica pyogenic

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

44

GATE BT 2024 | Question: 16
If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein. primary secondary tertiary quaternary

If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein.primarysecondarytertiary...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

45

GATE BT 2024 | Question: 17
All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$. protein with original function protein with altered function RNA with coding sequence RNA with regulatory function

All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$.protein with original functionprotein with altered functionRNA with coding sequenceRNA with regulatory function

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

46

GATE BT 2024 | Question: 18
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$. $1$ $2$ $3$ $4$

A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$.$1$$2$$3$$4$

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

47

GATE BT 2024 | Question: 19
The value of the series $1+\sin x+\cos ^{2} x+\sin ^{3} x+\cdots$ at $x=\frac{\pi}{4}$ is $\_\_\_\_\_\_\_$. $\frac{1}{\sqrt{2}+1}$ $\frac{\sqrt{2}}{\sqrt{2}+1}$ $\frac{1}{\sqrt{2}-1}$ $\frac{\sqrt{2}}{\sqrt{2}-1}$

The value of the series $1+\sin x+\cos ^{2} x+\sin ^{3} x+\cdots$ at $x=\frac{\pi}{4}$ is $\_\_\_\_\_\_\_$.$\frac{1}{\sqrt{2}+1}$$\frac{\sqrt{2}}{\sqrt{2}+1}$$\frac{1}{\s...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

48

GATE BT 2024 | Question: 20
The solution of the differential equation $\frac{d y}{d x}=y+e^{-x}$ that satisfies $y(0)=-\frac{1}{2}$ is $\_\_\_\_\_\_\_$. $-\frac{1}{2} e^{-\frac{x}{2}}$ $-\frac{1}{2} e^{x}$ $-\frac{1}{2} e^{-x}$ $-\frac{1}{2} e^{\frac{x}{2}}$

The solution of the differential equation $\frac{d y}{d x}=y+e^{-x}$ that satisfies $y(0)=-\frac{1}{2}$ is $\_\_\_\_\_\_\_$.$-\frac{1}{2} e^{-\frac{x}{2}}$$-\frac{1}{2} e...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

49

GATE BT 2024 | Question: 21
The six faces of a cube (die) are numbered as $1,2,3,4,5$ and $6$, and it is rolled once. An outcome is the observed number on the top face. If the probability of getting an odd number as an outcome is twice that of an even number, then the probability of getting a number less than $3$ is $\frac{1}{9}$ $\frac{2}{9}$ $\frac{1}{3}$ $\frac{4}{9}$

The six faces of a cube (die) are numbered as $1,2,3,4,5$ and $6$, and it is rolled once. An outcome is the observed number on the top face. If the probability of getting...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

50

GATE BT 2024 | Question: 22
Let $\overrightarrow{O R}$ be the vector that is perpendicular to the vectors $\overrightarrow{O P}=2 \hat{\imath}-3 \hat{\jmath}+\hat{k}$ and $\overrightarrow{O Q}=-2 \hat{\imath}+\hat{\jmath}+\hat{k}$. If the length of the vector $\overrightarrow{O R}$ is $\alpha \sqrt{3}$, then $\alpha$ is $\_\_\_\_\_\_\_$. $3$ $4$ $5$ $6$

Let $\overrightarrow{O R}$ be the vector that is perpendicular to the vectors $\overrightarrow{O P}=2 \hat{\imath}-3 \hat{\jmath}+\hat{k}$ and $\overrightarrow{O Q}=-2 \h...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

51

GATE BT 2024 | Question: 23
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.

The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

52

GATE BT 2024 | Question: 24
If the rate at which E. coli divides is $0.5 \mathrm{~h}^{-1}$, then its doubling time is $\_\_\_\_\_\_\_$ $\text{h}$.

If the rate at which E. coli divides is $0.5 \mathrm{~h}^{-1}$, then its doubling time is $\_\_\_\_\_\_\_$ $\text{h}$.

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

53

GATE BT 2024 | Question: 25
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will be $\_\_\_\_\_\_\_$ min (rounded off to $1$ decimal place).

The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will ...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

54

GATE BT 2024 | Question: 26
Match the disease (Column I) with its biological vector (Column II). \begin{array}{|c|c|c|} \hline \text{Column I} & \text{Column II} \\ \hline P. \text{Chagas disease} & 1. \text{Tsetse flies} \\ \hline Q. \text{Trypanosomiasis} & 2. \text{Mosquitoes} \\ \hline R. \text{ ... $\text{P-1; Q-4; R-3; S-2}$ $\text{P-3; Q-1; R-2; S-4}$

Match the disease (Column I) with its biological vector (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline P. \text{Chagas disease} & ...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

55

GATE BT 2024 | Question: 27
Match the industrial enzyme (Column I) with its application (Column II). \begin{array}{|c|c|c|} \hline \text{Column I} & \text{Column II} \\ \hline \text{P. Lipase} & 1. \text{Maltose syrup production} \\ \hline \text{Q. Ficin} & 2. \text{Oil degradation} \\ \hline \text{R. Amylase ... $\text{P-2; Q-3; R-1; S-4}$ $\text{P-1; Q-2; R-4; S-3}$

Match the industrial enzyme (Column I) with its application (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Lipase} & 1. \...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

56

GATE BT 2024 | Question: 28
Match the enzyme (Column I) with its corresponding function (Column II). \begin{array}{|c|c|c|} \hline & \text{Column I} & \text{Column II} \\ \hline & \text{P. Primase} & 1. \text{RNA dependent RNA synthesis} \\ \hline & \text{Q. Reverse transcriptase} & 2. \text{DNA ... $\text{P-3; Q-4; R-2; S-1}$ $\text{P-4; Q-3; R-1; S-2}$

Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

57

GATE BT 2024 | Question: 29
Match the item (Column I) with its corresponding use (Column II). \begin{array}{|c|c|c|} \hline \text{Column I} & \text{Column II} \\ \hline \text{P. Glutamine} & 1. \text{Detachment of adherent cells} \\ \hline \text{Q. Trypsin} & 2. \text{Selection of transfected mammalian cell ... $\text{P-2; Q-3; R-1; S-4}$ $\text{P-3; Q-1; R-4; S-2}$

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

58

GATE BT 2024 | Question: 30
Match the chemical (Column I) with its use (Column II). \begin{array}{|c|c|c|} \hline \text{Column I} & \text{Column II} \\ \hline \text{P. Diethylpyrocarbonate} & 1. \text{Chelation of magnesium ion during DNA purification}\\ \hline \text{Q. Cesium chloride} & 2. \text{Prevention of ... $\text{P-2; Q-1; R-4; S-3}$ $\text{P-2; Q-3; R-4; S-1}$

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

59

GATE BT 2024 | Question: 31
Match the item in Column I with the corresponding technique in Column II. \begin{array}{|c|c|c|} \hline & \text{Column I} & \text{Column II} \\ \hline & \text{P. Blue laser} & 1. \text{Electron microscopy} \\ \hline & \text{Q. Tungsten filament} & 2. \text{Fluorescence ... $\text{P-3; Q-1; R-4; S-2}$ $\text{P-3; Q-1; R-4; S-2}$

Match the item in Column I with the corresponding technique in Column II.\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Blue laser}...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

60

GATE BT 2024 | Question: 32
Match the genetic disorder (Column I) with its molecular basis (Column II). \begin{array}{|c|c|c|} \hline \text{Column I} & \text{Column II} \\ \hline \text{P. Sickle-cell anemia} & 1. \text{Mutation in nucleotide excision repair} \\ \hline \text{Q. Xeroderma pigmentosum} & 2. \text{ ... $\text{P-3; Q-1; R-4; S-2}$ $\text{P-4; Q-2; R-3; S-1}$

Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

61

GATE BT 2024 | Question: 33
The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution. convergent divergent neutral parallel

The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution.convergentdivergentneutralparallel

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

62

GATE BT 2024 | Question: 34
Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme? It binds to the substrate binding site of the enzyme only It binds to the enzyme-substrate complex only It reduces the $\mathrm{V}_{\max }$ of the enzyme It binds to both free enzyme and enzyme-substrate complex

Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme?It binds to the substrate binding site of the enzyme onlyIt binds to the en...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

63

GATE BT 2024 | Question: 35
Which of the following plant-based secondary metabolites belong(s) to the class of alkaloids? Ajmalicine $\left(\mathrm{C}_{21} \mathrm{H}_{24} \mathrm{~N}_2 \mathrm{O}_3\right)$ Azadirachtin $\left(\mathrm{C}_{35} \mathrm{H}_{44} \mathrm{O}_{16}\right)$ ... $\left(\mathrm{C}_{46} \mathrm{H}_{58} \mathrm{~N}_4 \mathrm{O}_9\right)$

Which of the following plant-based secondary metabolites belong(s) to the class of alkaloids? Ajmalicine $\left(\mathrm{C}_{21} \mathrm{H}_{24} \mathrm{~N}_2 \mathrm{O}_3...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

64

GATE BT 2024 | Question: 36
Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)? Differences in the number of recognition sites for a given restriction enzyme Differences in the ability of alleles to undergo recombination Differences in the ability of alleles to undergo segregation Differences in the number of tandem repeats

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

65

GATE BT 2024 | Question: 37
Which of the following is/are considered as biotic elicitor(s) in plant cell culture? Cellulase Chitin Chitosan Mercuric chloride

Which of the following is/are considered as biotic elicitor(s) in plant cell culture?CellulaseChitinChitosanMercuric chloride

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

66

GATE BT 2024 | Question: 38
Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle? Initiation of cell plate formation Incomplete DNA replication Chiasmata formation Irreparable DNA damage

Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle?Initiation of cell plate formationIncomplete DNA replicationC...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

67

GATE BT 2024 | Question: 39
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally? $2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acid Indole-$3$-butyric acid $1$-Naphthaleneacetic acid

Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

68

GATE BT 2024 | Question: 40
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE? $5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$ It contains nine codons in the reading frame It contains ten codons in the reading frame It codes for eight amino acids It codes for nine amino acids

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

69

GATE BT 2024 | Question: 41
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon? Absence of glucose Absence of lactose Presence of glucose Presence of lactose

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

70

GATE BT 2024 | Question: 42
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process? $\mathrm{pH}$ of the medium Osmolarity of the medium Substrate concentration in the medium Substrate feed rate

Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

71

GATE BT 2024 | Question: 43
Under complete cell washout condition in a chemostat with sterile feed, which of the following statements is/are correct? Biomass concentration in the reactor is maximum Substrate concentration in the exit stream is less than that in the inlet stream ... in the exit stream is equal to that in the inlet stream Substrate concentration in the exit stream is zero

Under complete cell washout condition in a chemostat with sterile feed, which of the following statements is/are correct?Biomass concentration in the reactor is maximumS...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

72

GATE BT 2024 | Question: 44
Fermentation medium is cooled from $121^{\circ} \mathrm{C}$ to $30{ }^{\circ} \mathrm{C}$ in a double pipe heat exchanger. If cold water is flowing in the counter-current direction and is heated from $10^{\circ} \mathrm{C}$ ... Temperature Difference (LMTD) is $\_\_\_\_\_\_\_$ ${ }^{\circ} \mathrm{C}$ (rounded off to the nearest integer).

Fermentation medium is cooled from $121^{\circ} \mathrm{C}$ to $30{ }^{\circ} \mathrm{C}$ in a double pipe heat exchanger. If cold water is flowing in the counter-current...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

73

GATE BT 2024 | Question: 45
Aspergillus niger is grown in a $10,000$ ... concentration is $\_\_\_\_\_\_\_$ $\mathrm{kg} \mathrm{m}^{-3}$ (Answer in integer).

Aspergillus niger is grown in a $10,000$ L stirred batch bioreactor under aerated conditions to produce citric acid. At steady state oxygen transfer conditions, the speci...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

74

GATE BT 2024 | Question: 46
Ethanol is produced in a $10,000$ L stirred bioreactor using an impeller of diameter $1 \mathrm{~m}$. The density and viscosity of fermentation broth are $1000 \mathrm{~kg} \mathrm{~m}^{-3}$ and $1 \mathrm{cp}$, respectively. The data relating the Power number and ... for the stirrer to operate at $300 \mathrm{rpm}$ is $\_\_\_\_\_\_$ $\mathrm{kW}$ (Answer in integer).

Ethanol is produced in a $10,000$ L stirred bioreactor using an impeller of diameter $1 \mathrm{~m}$. The density and viscosity of fermentation broth are $1000 \mathrm{~k...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

75

GATE BT 2024 | Question: 47
The free energy change of ATP hydrolysis at $25^{\circ} \mathrm{C}$ is $-32.2 \mathrm{~kJ} \mathrm{~mol}^{-1}$. The free energy change for hydrolysis of $\alpha$-glycerophosphate to glycerol is $-8.2 \mathrm{~kJ} \mathrm{~mol}^{-1}$ ... $\_\_\_\_\_\_\_\_$ $\mathrm{kJ} \mathrm{mol}^{-1}$ (Answer in integer).

The free energy change of ATP hydrolysis at $25^{\circ} \mathrm{C}$ is $-32.2 \mathrm{~kJ} \mathrm{~mol}^{-1}$. The free energy change for hydrolysis of $\alpha$-glycerop...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

76

GATE BT 2024 | Question: 48
E. coli is inoculated in a shake flask containing nutrient rich medium. The initial number of viable cells in the medium is $10^2$. After few hours, the number of viable cells is $10^6$. Assuming cell divides by binary fission, the number of generations that have taken place is $\_\_\_\_\_\_\_\_$ (rounded off to the nearest integer).

E. coli is inoculated in a shake flask containing nutrient rich medium. The initial number of viable cells in the medium is $10^2$. After few hours, the number of viable ...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

77

GATE BT 2024 | Question: 49
A fermentor is filled with medium at a rate of $1 \mathrm{~L} \mathrm{~min}^{-1}$. A leak develops at the bottom of the fermentor when the medium in the fermentor reaches $200 \mathrm{~L}$ ... medium in the fermentor after $10 \mathrm{~min}$ of leakage is $\_\_\_\_\_\_\_\_$ $\text{L}$ (Answer in integer).

A fermentor is filled with medium at a rate of $1 \mathrm{~L} \mathrm{~min}^{-1}$. A leak develops at the bottom of the fermentor when the medium in the fermentor reaches...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

78

GATE BT 2024 | Question: 50
A fed batch process is running at quasi-steady state with respect to substrate and biomass concentration. At $2 \mathrm{~h}$, the culture volume is $500 \mathrm{~L}$ with a constant sterile inlet feed at $50 \mathrm{~L} \mathrm{~h}^{-1}$ of glucose. The culture kinetic ... reactor will be $\_\_\_\_\_\_\_\_$ $\mathrm{g} \mathrm{L}^{-1}$ (rounded off to one decimal place).

A fed batch process is running at quasi-steady state with respect to substrate and biomass concentration. At $2 \mathrm{~h}$, the culture volume is $500 \mathrm{~L}$ with...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

79

GATE BT 2024 | Question: 51
Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ ... is constant shear. The impeller speed in the prototype reactor will be $\_\_\_\_\_\_\_$ rm (Answer in integer).

Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ prototype stirred tank reactor. The model-type and prototype have the ...

admin

2.7k points

admin asked Mar 25

0 votes

0 answers

80

GATE BT 2024 | Question: 52
If $\vec{v}=\left(\begin{array}{l}2 \\ 2 \\ 2\end{array}\right)$ is an eigenvector of the matrix $\left(\begin{array}{lll}1 & 2 & 3 \\ 1 & 2 & 3 \\ 1 & 2 & 3\end{array}\right)$ corresponding to the non-zero eigenvalue, $\lambda$, then the value of $\lambda$ is $\_\_\_\_\_\_\_\_$.

If $\vec{v}=\left(\begin{array}{l}2 \\ 2 \\ 2\end{array}\right)$ is an eigenvector of the matrix $\left(\begin{array}{lll}1 & 2 & 3 \\ 1 & 2 & 3 \\ 1 & 2 & 3\end{array}\r...

admin

2.7k points

admin asked Mar 25