Register
Filter

Hot questions

0 votes
0 answers
2
GATE BT 2024 | Question: 16
If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein. primary secondary tertiary quaternary
If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein.primarysecondarytertiary...
0 votes
0 answers
3
GATE BT 2024 | Question: 20
The solution of the differential equation $\frac{d y}{d x}=y+e^{-x}$ that satisfies $y(0)=-\frac{1}{2}$ is $\_\_\_\_\_\_\_$. $-\frac{1}{2} e^{-\frac{x}{2}}$ $-\frac{1}{2} e^{x}$ $-\frac{1}{2} e^{-x}$ $-\frac{1}{2} e^{\frac{x}{2}}$
The solution of the differential equation $\frac{d y}{d x}=y+e^{-x}$ that satisfies $y(0)=-\frac{1}{2}$ is $\_\_\_\_\_\_\_$.$-\frac{1}{2} e^{-\frac{x}{2}}$$-\frac{1}{2} e...
0 votes
0 answers
4
GATE BT 2024 | Question: 5
The relationship that involves the exchange of nutrients between two different species for their mutual growth is called $\_\_\_\_\_\_\_\_$ antagonism commensalism parasitism syntrophism
The relationship that involves the exchange of nutrients between two different species for their mutual growth is called $\_\_\_\_\_\_\_\_$antagonismcommensalismparasitis...
0 votes
0 answers
5
GATE BT 2024 | GA Question: 4
The number of coins of ₹ $1$, ₹ $5$, and ₹ $10$ denominations that a person has are in the ratio $5: 3: 13$. Of the total amount, the percentage of money in ₹ $5$ coins is $21 \%$ $14 \frac{2}{7} \%$ $10 \%$ $30 \%$
The number of coins of ₹ $1$, ₹ $5$, and ₹ $10$ denominations that a person has are in the ratio $5: 3: 13$. Of the total amount, the percentage of money in ₹ $5$...
0 votes
0 answers
6
GATE BT 2024 | Question: 17
All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$. protein with original function protein with altered function RNA with coding sequence RNA with regulatory function
All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$.protein with original functionprotein with altered functionRNA with coding sequenceRNA with regulatory function
0 votes
0 answers
7
GATE BT 2024 | Question: 11
Which one of the following bacteriophages has a genome composed of single stranded circular DNA? $\emptyset \text{X} 174$ $\lambda$ $\text{T}5$ $\text{P}1$
Which one of the following bacteriophages has a genome composed of single stranded circular DNA?$\emptyset \text{X} 174$$\lambda$$\text{T}5$$\text{P}1$
0 votes
0 answers
8
GATE BT 2024 | Question: 6
Mendel's 'law of segregation' applies to the segregation of $\_\_\_\_\_\_\_\_$ during gamete formation. mitochondrial genes alleles of a gene linked genes on the same chromosome unlinked genes on the same chromosome
Mendel's 'law of segregation' applies to the segregation of $\_\_\_\_\_\_\_\_$ during gamete formation.mitochondrial genesalleles of a genelinked genes on the same chromo...
0 votes
0 answers
9
GATE BT 2024 | Question: 13
Which one of the following is the basic principle of Sanger's DNA sequencing method? Chain termination by incorporation of dideoxynucleotides Chain elongation by incorporation of dideoxynucleotides Release of inorganic pyrophosphate Chain cleavage by modification of dideoxynucleotides
Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...
0 votes
0 answers
10
GATE BT 2024 | Question: 2
The transfer function of a process is $G(s)=\frac{K_{p}}{\tau_{p} s+1}$, where $K_{p}$ is the gain and $\tau_{p}$ is the time constant. This is a $\_\_\_\_\_\_$ process. first order multi-capacity purely capacity second order
The transfer function of a process is $G(s)=\frac{K_{p}}{\tau_{p} s+1}$, where $K_{p}$ is the gain and $\tau_{p}$ is the time constant. This is a $\_\_\_\_\_\_$ process.f...
0 votes
0 answers
12
GATE BT 2024 | Question: 12
Which one of the following is an insect cell line? $\text{HEK} 293$ $\text{Sf}9$ $\text{DH}5$ $\alpha$ $\text{CHO}$
Which one of the following is an insect cell line?$\text{HEK} 293$$\text{Sf}9$$\text{DH}5$ $\alpha$ $\text{CHO}$
0 votes
0 answers
15
GATE BT 2024 | Question: 51
Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ ... is constant shear. The impeller speed in the prototype reactor will be $\_\_\_\_\_\_\_$ rm (Answer in integer).
Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ prototype stirred tank reactor. The model-type and prototype have the ...
0 votes
0 answers
16
GATE BT 2024 | GA Question: 3
Consider the following sample of numbers: \[ 9,18,11,14,15,17,10,69,11,13 \] The median of the sample is $13.5$ $14$ $11$ $18.7$
Consider the following sample of numbers:\[9,18,11,14,15,17,10,69,11,13\]The median of the sample is$13.5$$14$$11$$18.7$
0 votes
0 answers
19
GATE BT 2024 | Question: 54
Let $y(x)=x^2 \ln x$ for $x>0$, be a solution of $x^2 \frac{d^2 y}{d x^2}+4 y=\alpha x \frac{d y}{d x}$. Then the value of $\alpha$ is $\_\_\_\_\_\_\_\_\_$.
Let $y(x)=x^2 \ln x$ for $x>0$, be a solution of $x^2 \frac{d^2 y}{d x^2}+4 y=\alpha x \frac{d y}{d x}$. Then the value of $\alpha$ is $\_\_\_\_\_\_\_\_\_$.
0 votes
0 answers
20
GATE BT 2024 | Question: 8
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule. $\text{C-N}$ $\text{N-O}$ $\text{S-C}$ $\text{S-S}$
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule.$\text{C-N}$ $\text{N-O}$$\text{S-C}$$\text{S-S...
0 votes
0 answers
22
GATE BT 2024 | GA Question: 10
The least number of squares to be added in the figure to make AB a line of symmetry is $6$ $4$ $5$ $7$
The least number of squares to be added in the figure to make AB a line of symmetry is$6$$4$ $5$ $7$
0 votes
0 answers
23
GATE BT 2024 | Question: 25
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will be $\_\_\_\_\_\_\_$ min (rounded off to $1$ decimal place).
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will ...
0 votes
0 answers
24
GATE BT 2024 | Question: 1
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$. covalent bonds electrostatic interactions ionic bonds van der Waals forces
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$.covalent bondselectrostatic interac...
0 votes
0 answers
25
GATE BT 2024 | Question: 7
Co-translational translocation of proteins is observed in $\_\_\_\_\_\_\_$. endoplasmic reticulum Golgi complex mitochondria peroxisomes
Co-translational translocation of proteins is observed in $\_\_\_\_\_\_\_$.endoplasmic reticulumGolgi complexmitochondriaperoxisomes
0 votes
0 answers
26
GATE BT 2024 | Question: 23
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.
0 votes
0 answers
29
GATE BT 2024 | Question: 15
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway. only an anabolic only a catabolic an amphibolic a pyogenic
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway.only an anaboliconly a catabolic an amphibolica pyogenic
0 votes
0 answers
30
GATE BT 2024 | Question: 40
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE? $5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$ It contains nine codons in the reading frame It contains ten codons in the reading frame It codes for eight amino acids It codes for nine amino acids
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...
0 votes
0 answers
31
GATE BT 2024 | GA Question: 2
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$ depends on $x y$ depends only on $x$ and not on $y$ depends only on $y$ and not on $x$ is a constant
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$depends on $x y$depends only on $x$ an...
0 votes
0 answers
33
GATE BT 2024 | Question: 39
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally? $2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acid Indole-$3$-butyric acid $1$-Naphthaleneacetic acid
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...
0 votes
0 answers
34
GATE BT 2024 | Question: 42
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process? $\mathrm{pH}$ of the medium Osmolarity of the medium Substrate concentration in the medium Substrate feed rate
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...
0 votes
0 answers
35
GATE BT 2024 | Question: 9
During normal embryonic development of the mice paw, elimination of cells from the inter-digital space is due to $\_\_\_\_\_\_\_$. apoptosis meiosis mutagenesis necrosis
During normal embryonic development of the mice paw, elimination of cells from the inter-digital space is due to $\_\_\_\_\_\_\_$.apoptosismeiosismutagenesisnecrosis
0 votes
0 answers
36
GATE BT 2024 | Question: 18
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$. $1$ $2$ $3$ $4$
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$.$1$$2$$3$$4$
0 votes
0 answers
37
GATE BT 2024 | Question: 24
If the rate at which E. coli divides is $0.5 \mathrm{~h}^{-1}$, then its doubling time is $\_\_\_\_\_\_\_$ $\text{h}$.
If the rate at which E. coli divides is $0.5 \mathrm{~h}^{-1}$, then its doubling time is $\_\_\_\_\_\_\_$ $\text{h}$.
0 votes
0 answers
38
GATE BT 2024 | Question: 33
The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution. convergent divergent neutral parallel
The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution.convergentdivergentneutralparallel
0 votes
0 answers
39
GATE BT 2024 | Question: 41
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon? Absence of glucose Absence of lactose Presence of glucose Presence of lactose
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...
Page: