Recent questions tagged gatebt-2024

In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$.covalent bondselectrostatic interac...

The transfer function of a process is $G(s)=\frac{K_{p}}{\tau_{p} s+1}$, where $K_{p}$ is the gain and $\tau_{p}$ is the time constant. This is a $\_\_\_\_\_\_$ process.f...

Mendel's 'law of segregation' applies to the segregation of $\_\_\_\_\_\_\_\_$ during gamete formation.mitochondrial genesalleles of a genelinked genes on the same chromo...

Co-translational translocation of proteins is observed in $\_\_\_\_\_\_\_$.endoplasmic reticulumGolgi complexmitochondriaperoxisomes

$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule.$\text{C-N}$ $\text{N-O}$$\text{S-C}$$\text{S-S...

A cultured skin fibroblast cell of a goat ' $\mathrm{P}$ ' was fused with an enucleated ovum of a goat ' $\mathrm{Q}$ '. The resultant activated early embryo was then tra...

Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...

An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$carbonnitrogenoxygenphosphorous

Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway.only an anaboliconly a catabolic an amphibolica pyogenic

If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein.primarysecondarytertiary...

All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$.protein with original functionprotein with altered functionRNA with coding sequenceRNA with regulatory function

A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$.$1$$2$$3$$4$

The value of the series $1+\sin x+\cos ^{2} x+\sin ^{3} x+\cdots$ at $x=\frac{\pi}{4}$ is $\_\_\_\_\_\_\_$.$\frac{1}{\sqrt{2}+1}$$\frac{\sqrt{2}}{\sqrt{2}+1}$$\frac{1}{\s...

The solution of the differential equation $\frac{d y}{d x}=y+e^{-x}$ that satisfies $y(0)=-\frac{1}{2}$ is $\_\_\_\_\_\_\_$.$-\frac{1}{2} e^{-\frac{x}{2}}$$-\frac{1}{2} e...

The six faces of a cube (die) are numbered as $1,2,3,4,5$ and $6$, and it is rolled once. An outcome is the observed number on the top face. If the probability of getting...

Match the industrial enzyme (Column I) with its application (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Lipase} & 1. \...

Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

Match the item in Column I with the corresponding technique in Column II.\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Blue laser}...

Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...

The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution.convergentdivergentneutralparallel

Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme?It binds to the substrate binding site of the enzyme onlyIt binds to the en...

Which of the following plant-based secondary metabolites belong(s) to the class of alkaloids? Ajmalicine $\left(\mathrm{C}_{21} \mathrm{H}_{24} \mathrm{~N}_2 \mathrm{O}_3...

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

Which of the following is/are considered as biotic elicitor(s) in plant cell culture?CellulaseChitinChitosanMercuric chloride

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...

Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...