Recent questions and answers in Recombinant DNA technology and Other Tools in Biotechnology

Which component of the $\text{CRISPR/Cas9}$ gene editing system is $\text{NOT}$ of natural origin?$\text{CAS9}$ protein$\text{CRISPR}$ repeats$\text{PAM}$ sequence$\text{...

​​​​​Which one of the following hosts is used in mammalian cell culture for the production of glycosylated recombinant therapeutic proteins?Pichia pastorisSf$9$ cellsEsch...

​​​​Which of the following methods is/are used for identifying histone modifications?ChIP-seqMass spectrometryImmunofluorescencePatch-clamp electrophysiology

Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...

Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

In hybridoma technology, which one of the following enzymes is absent in the myeloma cells that are used for monoclonal antibody production?Hypoxanthine-guanine phosphori...

Which of the following methods are used for detection of DNA and RNA, respectively?Southern and Northern blotting Southern and Western blottingNorthern and Southern blott...

Direct DNA transfer method(s) used for plant genetic engineering is(are)microparticle bombardmentelectroporationpolyethylene glycol treatmentAgrobacterium-mediated transf...

Which of the following vector(s) is(are) used to clone a DNA fragment of size $220 \mathrm{~kb}$?Bacterial artificial chromosomeYeast artificial chromosomeCosmids$\text{p...

The recognition sequences of four Type-II restriction enzymes $\text{(RE)}$ are given below. The symbol $(\downarrow)$ indicates the cleavage site. Identify the $\text{RE...

Among individuals in a human population, minor variations exist in nucleotide sequences of chromosomes. These variations can lead to gain or loss of sites for specific re...

Introduction of foreign genes into plant cells can be carried out usingAgrobacterium$\text{Cacl}_{2}$ mediated plasmid uptakeElectroporationGene gun

Which one of the following techniques/tools is $\text{NOT}$ used for inserting a foreign gene into a cell?$\text{DNA}$ microarrayElectroporationGene gunMicroinjection

The enzyme which adds phosphate group to the free $5’$ terminus of a $\text{DNA}$ sequence isadenosine kinasealkaline phosphatasepolynucleotide kinaseterminal deoxynucleo...

For site-directed mutagenesis, which one of the following restriction enzymes is used to digest methylated $DNA$?$KpnI$$DpnI$$XhoI$$MluI$

Which of the following factors affect the fidelity of $DNA$ polymerase in polymerase chain reaction?$Mg^{2+}$ concentration$pH$Annealing temperature$P$ and $Q$ only$P$ an...

The schematic of a plasmid with a gap in one of the strands is shown below:Which of the following enzyme(s) is/are required to fill the gap and generate a covalently clos...

Determine the correctness or otherwise of the following Assertion [$a$] and the Reason [$r$].Assertion [$a$]: A genetically engineered rice that produces beta-carotene in...

During a positive-negative selection process, transformed animal cells expressing __________________ are killed in presence of ganciclovir in the medium.Pyruvate kinasevi...

A vector derived from which one of the following viruses is used for high - frequency genomic integration of a transgene in animal cells?AdenoviruAdeno-associated virusLe...

Which one of the following statements about $Agrobacterium \;Ti\; plasmid$ is $CORRECT$?$Vir$ genes are located within the $T-DNA$ segmentPhytohormone biosynthesis genes ...

The Bt toxin gene from $Bacillus\; thuringiensis$ used to generate genetically modified crops is$cry$$cro$$cdc$$cre$

Which one of the following techniques can be used to compare the expression of a large number of genes in two biological samples in a single experiment?Polymerase chain r...

Which one of the following is NOT a therapeutic agent based on nucleic acid for the treatment of genetic disorders?Antisense oligonucleotideRibozymeAptamerAvidin

Select the CORRECT combination of genetic components that are essential for the transfer of T-DNA segment from Agrobacterium tumefaciens to plant cells.Border repeat sequ...

A $1.2$ kb DNA fragment was cloned into $\textit{Bam}$HI and $\textit{Eco}$RI sites located on a $2.8$ kb cloning vector. The $\textit{Bam}$HI and $\textit{Eco}$RI sites ...

A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...

A recombinant protein is to be expressed under the control of the lac promoter and operator in a strain $\textit{E.coli}$ having the genotype lacI$^+$ crp$^+$ . Even in t...

Shown below id a plasmid vector (P) and an insert (Q). The insert was cloned into the BamHI site of the vector. The recombinant plasmid was isolated and digested with Bam...

Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT

EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...

Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice

Which one of the following features is NOT required in a prokaryotic expression vector?$\textit{oriC}$Selection markerCMV promoterRibosome binding site

In DNA sequencing reactions using the chain termination method, the ratio of ddNTPs to dNTPs should be$0$$< 1$$1$$>1$

Choose the appropriate pair of primers to amplify the following DNA fragment by the polymerase chain reaction (PCR).$$\textrm{5’ – GACCTGTGG- – – – – – – – – – – – – – – ...

A linear double stranded DNA of length $8$ kbp has three restriction sites. Each of these can either be a $\textit{Bam}\text{HI}$ or a $\textit{Hae}III$ site. The DNA was...

The 4-amino or 4-keto group of pyrimidine bases is located in themajor groove of the double stranded DNAminor groove of the double stranded DNAminor groove of the B form ...