Recent questions tagged recombinant-dna-technology

Which component of the $\text{CRISPR/Cas9}$ gene editing system is $\text{NOT}$ of natural origin?$\text{CAS9}$ protein$\text{CRISPR}$ repeats$\text{PAM}$ sequence$\text{...

​​​​​Which one of the following hosts is used in mammalian cell culture for the production of glycosylated recombinant therapeutic proteins?Pichia pastorisSf$9$ cellsEsch...

​​​​Correctly match the herbicide with its mode of development of resistance in plants.\begin{array}{|l|l|}\hline \textbf{Herbicide } & \textbf{Mode of development of res...

A cultured skin fibroblast cell of a goat ' $\mathrm{P}$ ' was fused with an enucleated ovum of a goat ' $\mathrm{Q}$ '. The resultant activated early embryo was then tra...

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

Direct DNA transfer method(s) used for plant genetic engineering is(are)microparticle bombardmentelectroporationpolyethylene glycol treatmentAgrobacterium-mediated transf...

Which of the following vector(s) is(are) used to clone a DNA fragment of size $220 \mathrm{~kb}$?Bacterial artificial chromosomeYeast artificial chromosomeCosmids$\text{p...

The recognition sequences of four Type-II restriction enzymes $\text{(RE)}$ are given below. The symbol $(\downarrow)$ indicates the cleavage site. Identify the $\text{RE...

Among individuals in a human population, minor variations exist in nucleotide sequences of chromosomes. These variations can lead to gain or loss of sites for specific re...

Introduction of foreign genes into plant cells can be carried out usingAgrobacterium$\text{Cacl}_{2}$ mediated plasmid uptakeElectroporationGene gun

A circular plasmid has three different but unique restriction sites for enzymes $‘\text{a'}, ‘\text{b'}$ and $‘\text{c'}.$ When enzymes $‘\text{a'}$ and $‘\text{b'}$ are ...

Which one of the following techniques/tools is $\text{NOT}$ used for inserting a foreign gene into a cell?$\text{DNA}$ microarrayElectroporationGene gunMicroinjection

Which of the following statement(s) is/are $\text{CORRECT}$ about $\textit{Agrobacterium tumefaciens}$?It contains tumor inducing plasmidIt causes crown gall disease in d...

The possible number of $\textit{Sal}\text{I}$ restriction sites in a $9\text{ kb}$ double-stranded $\text{DNA}$, with all four bases occurring in equal proportion (rounde...

For site-directed mutagenesis, which one of the following restriction enzymes is used to digest methylated $DNA$?$KpnI$$DpnI$$XhoI$$MluI$

Determine the correctness or otherwise of the following Assertion $[a]$ and the Reason $[r]$Assertion $[a]$ : It is possible to regenerate a whole plant from a single pla...

The schematic of a plasmid with a gap in one of the strands is shown below:Which of the following enzyme(s) is/are required to fill the gap and generate a covalently clos...

Determine the correctness or otherwise of the following Assertion [$a$] and the Reason [$r$].Assertion [$a$]: A genetically engineered rice that produces beta-carotene in...

During a positive-negative selection process, transformed animal cells expressing __________________ are killed in presence of ganciclovir in the medium.Pyruvate kinasevi...

A vector derived from which one of the following viruses is used for high - frequency genomic integration of a transgene in animal cells?AdenoviruAdeno-associated virusLe...

Which one of the following statements about $Agrobacterium \;Ti\; plasmid$ is $CORRECT$?$Vir$ genes are located within the $T-DNA$ segmentPhytohormone biosynthesis genes ...

Select the CORRECT combination of genetic components that are essential for the transfer of T-DNA segment from Agrobacterium tumefaciens to plant cells.Border repeat sequ...

A variety of genetic elements are used in the transgenic plant research. Match the genetic elements (Column-I) with their corresponding source (Column-ll).$\begin{array}{...

A $1.2$ kb DNA fragment was cloned into $\textit{Bam}$HI and $\textit{Eco}$RI sites located on a $2.8$ kb cloning vector. The $\textit{Bam}$HI and $\textit{Eco}$RI sites ...

A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...

A recombinant protein is to be expressed under the control of the lac promoter and operator in a strain $\textit{E.coli}$ having the genotype lacI$^+$ crp$^+$ . Even in t...

Shown below id a plasmid vector (P) and an insert (Q). The insert was cloned into the BamHI site of the vector. The recombinant plasmid was isolated and digested with Bam...

Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT

EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...

Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice

Which one of the following features is NOT required in a prokaryotic expression vector?$\textit{oriC}$Selection markerCMV promoterRibosome binding site

In DNA sequencing reactions using the chain termination method, the ratio of ddNTPs to dNTPs should be$0$$< 1$$1$$>1$

Choose the appropriate pair of primers to amplify the following DNA fragment by the polymerase chain reaction (PCR).$$\textrm{5’ – GACCTGTGG- – – – – – – – – – – – – – – ...

Plasmid DNA $(0.5 \: \mu g)$ containing an ampicillin resistance marker was added to $200 \: \mu l$ of competent cells. The transformed competent cells were diluted $10,0...

Assuming random distribution of nucleotides, the average number of fragments generated upon digestion of a circular DNA of size $4.3 \times 10^5$ bp with $\textit{Alu}I (...

A linear double stranded DNA of length $8$ kbp has three restriction sites. Each of these can either be a $\textit{Bam}\text{HI}$ or a $\textit{Hae}III$ site. The DNA was...

The plasmid DNA was subjected to restriction digestion using the enzyme $\textit{EcoRI}$ and analysed on an agarose gel. Assuming digestion has worked (the enzyme was act...

In nature, $\text{Agrobacterium tumefaciens}$ mediated infection of plant cells leads toP. crown gall disease in plantsQ. hairy root disease in plantsR. transfer of $\tex...

The nucleotide analogue used in DNA sequencing by chain termination method is$l',3'-$dideoxy nucleoside triphosphate$2',3'-$dideoxy nucleoside triphosphate$2',4'-$dideoxy...

Human genome sequencing project involved the construction of genomic library inbacterial artificial chromosome$pBR322$bacteriophage$pcDNA3.1$