Register

GATE BT 2017 | Question: 51

• recategorized by

Please log in or register to answer this question.

Voting & Accepting an answer helps improve the community
Answer:

Related questions

0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 20
A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...
0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 0 votes
0 0 answers
soujanyareddy13 asked Nov 3, 2020
GATE2019: 27
For site-directed mutagenesis, which one of the following restriction enzymes is used to digest methylated $DNA$?$KpnI$$DpnI$$XhoI$$MluI$
0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2015 | Question: 30
In DNA sequencing reactions using the chain termination method, the ratio of ddNTPs to dNTPs should be$0$$< 1$$1$$>1$
0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 23
The transcription factor $X$ binds a $10$ base pair DNA stretch. In the DNA of an organism, $X$ was found to bind at $20$ distinct sites. An analysis of these $20$ bindin...