Register

GATE BT 2017 | Question: 20

• recategorized by

Please log in or register to answer this question.

Voting & Accepting an answer helps improve the community
Answer:

Related questions

0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 42
A recombinant protein is to be expressed under the control of the lac promoter and operator in a strain $\textit{E.coli}$ having the genotype lacI$^+$ crp$^+$ . Even in t...
0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 43
Shown below id a plasmid vector (P) and an insert (Q). The insert was cloned into the BamHI site of the vector. The recombinant plasmid was isolated and digested with Bam...
0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 0 votes
0 0 answers
Milicevic3306 asked Mar 26, 2018
GATE BT 2017 | Question: 51
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...
0 0 votes
0 0 answers
admin asked Mar 25, 2024
GATE BT 2024 | Question: 36
Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...