Recent questions tagged molecular-biology-and-genetics

Cancer cells display a high level of heterogeneity in the expression of TP$53$ protein. Which of the following techniques can be directly used to determine the intratumor...

In nitrogen fixation, to reduce nitrogen to ammonia, which one of the following shows the correct order of electron flow?Ferredoxin → reductase → nitrogenaseNADH → reduct...

The RNA primer synthesized during bacterial DNA replication is removed by $\_\_\_\_$.DNA gyraseDNA Polymerase $\text{I}$PrimaseDNA Polymerase $\text{III}$

Which component of the $\text{CRISPR/Cas9}$ gene editing system is $\text{NOT}$ of natural origin?$\text{CAS9}$ protein$\text{CRISPR}$ repeats$\text{PAM}$ sequence$\text{...

Which of the following drugs inhibit(s) $\text{ATP-ADP}$ translocase?OligomycinAtractylosideAmytalBongkrekic acid

Match the genetic disorders in Column $\text{I}$ to the corresponding underlying cause in Column $\text{II}$\[\begin{array}{|l|l|}\hline\text{Column I} & \text{Column II}...

Match the biomolecules in Column $\text{I}$ with their function given in Column $\text{II}$\[\begin{array}{|l|l|}\hline\text{Column I} & \text{Column II} \\\hline\text{P....

Messenger $\text{RNAs (mRNAs)}$ translate to generate polypeptides and the translation terminates at the $\text{UGA, UAG}$ or $\text{UAA}$ stop codons. The $\text{AGA}$ c...

The RNA sequence below depicts the part of a $330$ nucleotides long $\text{mRNA}$ and it encodes the $\text{C}$-terminal portion of a protein.$5^{\prime}-\ldots \ldots$ $...

Which of the following is/are posttranslational modification(s) involved in epigenetic control of gene expression?Arginine methylationLysine acetylationCytosine methylati...

​​​​​The diversity in $T$-cell receptors is generated bygene rearrangementssomatic hypermutation of rearranged $V$ regiongene conversionclass switching

​​​​Which one of the following is true for piRNAs?piRNAs silence transposable elements in germ cellspiRNA is the abbreviation of $P$-element interacting RNApiRNAs modify ...

​​​​Which of the following features is/are used to distinguish Archaea from Bacteria?Gram-stainingPeptidoglycan in the cell wallPresence of N -acetylglucosamine$16 S$ rRN...

​​​​Which of the following enzymes is/are involved in the biogenesis of miRNA?DroshaCas$9$XRCC$4$Dicer

The contour length of a B-DNA molecule that encodes a bacterial protein of $33 \: \text{kDa}$ is $\_\_\_\_$ $\mathrm{ nm}$.Consider the average molecular weight of an ami...

Correctly match the Inhibitor with its respective Function in mitochondrial respiration.\[\begin{array}{|l|}\hline\begin{array}{l|l}\textbf{Inhibitor} & \textbf{Function}...

Correctly match the Enzyme with its respective Function.\begin{array}{|l|l|}\hline \textbf{ Enzyme } & \textbf{ Function } \\\hline \text{P. Gyrase} & 1. \text{Removes a ...

​​​​Correctly match the herbicide with its mode of development of resistance in plants.\begin{array}{|l|l|}\hline \textbf{Herbicide } & \textbf{Mode of development of res...

​​​​​Which of the following statements is/are true regarding the effect of the concentration of metabolic intermediates on glycolysis in erythrocytes?Increased AMP levels...

​​​​Which of the following statements about initiation of DNA replication in eukaryotes is/are true?DNA replication is initiated at the origin of replication licensed by ...

​​​​Which of the following proteins is/are involved in intraflagellar transport?MicrotubulesMyosinActinKinesin

​​​​Which of the following statements is/are true about telomerase?Telomerase has $5^{\prime}-3^{\prime}$ DNA-dependent DNA polymerisation activityTelomerase has $5^{\pri...

​​​​Which of the following methods is/are used for identifying histone modifications?ChIP-seqMass spectrometryImmunofluorescencePatch-clamp electrophysiology

Mendel's 'law of segregation' applies to the segregation of $\_\_\_\_\_\_\_\_$ during gamete formation.mitochondrial genesalleles of a genelinked genes on the same chromo...

Co-translational translocation of proteins is observed in $\_\_\_\_\_\_\_$.endoplasmic reticulumGolgi complexmitochondriaperoxisomes

A cultured skin fibroblast cell of a goat ' $\mathrm{P}$ ' was fused with an enucleated ovum of a goat ' $\mathrm{Q}$ '. The resultant activated early embryo was then tra...

Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...

An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$carbonnitrogenoxygenphosphorous

All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$.protein with original functionprotein with altered functionRNA with coding sequenceRNA with regulatory function

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle?Initiation of cell plate formationIncomplete DNA replicationC...

Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...