Recent questions in Recombinant DNA technology and Other Tools in Biotechnology

0 0 votes
0 0 answers
Which component of the $\text{CRISPR/Cas9}$ gene editing system is $\text{NOT}$ of natural origin?$\text{CAS9}$ protein$\text{CRISPR}$ repeats$\text{PAM}$ sequence$\text{...
0 0 votes
0 0 answers
​​​​​Which one of the following hosts is used in mammalian cell culture for the production of glycosylated recombinant therapeutic proteins?Pichia pastorisSf$9$ cellsEsch...
0 0 votes
0 0 answers
​​​​Which of the following methods is/are used for identifying histone modifications?ChIP-seqMass spectrometryImmunofluorescencePatch-clamp electrophysiology
1 1 vote
0 0 answers
Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...
0 0 votes
0 0 answers
Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...
0 0 votes
0 0 answers
Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...
0 0 votes
0 0 answers
Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...
0 0 votes
0 0 answers
In hybridoma technology, which one of the following enzymes is absent in the myeloma cells that are used for monoclonal antibody production?Hypoxanthine-guanine phosphori...
0 0 votes
0 0 answers
Which of the following methods are used for detection of DNA and RNA, respectively?Southern and Northern blotting Southern and Western blottingNorthern and Southern blott...
1 1 vote
0 0 answers
Direct DNA transfer method(s) used for plant genetic engineering is(are)microparticle bombardmentelectroporationpolyethylene glycol treatmentAgrobacterium-mediated transf...
0 0 votes
0 0 answers
Which of the following vector(s) is(are) used to clone a DNA fragment of size $220 \mathrm{~kb}$?Bacterial artificial chromosomeYeast artificial chromosomeCosmids$\text{p...
0 0 votes
0 0 answers
The recognition sequences of four Type-II restriction enzymes $\text{(RE)}$ are given below. The symbol $(\downarrow)$ indicates the cleavage site. Identify the $\text{RE...
0 0 votes
0 0 answers
Among individuals in a human population, minor variations exist in nucleotide sequences of chromosomes. These variations can lead to gain or loss of sites for specific re...
0 0 votes
0 0 answers
Introduction of foreign genes into plant cells can be carried out usingAgrobacterium$\text{Cacl}_{2}$ mediated plasmid uptakeElectroporationGene gun
0 0 votes
0 0 answers
Which one of the following techniques/tools is $\text{NOT}$ used for inserting a foreign gene into a cell?$\text{DNA}$ microarrayElectroporationGene gunMicroinjection
0 0 votes
0 0 answers
The enzyme which adds phosphate group to the free $5’$ terminus of a $\text{DNA}$ sequence isadenosine kinasealkaline phosphatasepolynucleotide kinaseterminal deoxynucleo...
0 0 votes
0 0 answers
For site-directed mutagenesis, which one of the following restriction enzymes is used to digest methylated $DNA$?$KpnI$$DpnI$$XhoI$$MluI$
0 0 votes
0 0 answers
Which of the following factors affect the fidelity of $DNA$ polymerase in polymerase chain reaction?$Mg^{2+}$ concentration$pH$Annealing temperature$P$ and $Q$ only$P$ an...
0 0 votes
0 0 answers
The schematic of a plasmid with a gap in one of the strands is shown below:Which of the following enzyme(s) is/are required to fill the gap and generate a covalently clos...
0 0 votes
0 0 answers
Determine the correctness or otherwise of the following Assertion [$a$] and the Reason [$r$].Assertion [$a$]: A genetically engineered rice that produces beta-carotene in...
0 0 votes
0 0 answers
During a positive-negative selection process, transformed animal cells expressing __________________ are killed in presence of ganciclovir in the medium.Pyruvate kinasevi...
0 0 votes
0 0 answers
A vector derived from which one of the following viruses is used for high - frequency genomic integration of a transgene in animal cells?AdenoviruAdeno-associated virusLe...
0 0 votes
0 0 answers
Which one of the following statements about $Agrobacterium \;Ti\; plasmid$ is $CORRECT$?$Vir$ genes are located within the $T-DNA$ segmentPhytohormone biosynthesis genes ...
0 0 votes
0 0 answers
The Bt toxin gene from $Bacillus\; thuringiensis$ used to generate genetically modified crops is$cry$$cro$$cdc$$cre$
0 0 votes
0 0 answers
Which one of the following techniques can be used to compare the expression of a large number of genes in two biological samples in a single experiment?Polymerase chain r...
0 0 votes
0 0 answers
Which one of the following is NOT a therapeutic agent based on nucleic acid for the treatment of genetic disorders?Antisense oligonucleotideRibozymeAptamerAvidin
0 0 votes
0 0 answers
Select the CORRECT combination of genetic components that are essential for the transfer of T-DNA segment from Agrobacterium tumefaciens to plant cells.Border repeat sequ...
0 0 votes
0 0 answers
A $1.2$ kb DNA fragment was cloned into $\textit{Bam}$HI and $\textit{Eco}$RI sites located on a $2.8$ kb cloning vector. The $\textit{Bam}$HI and $\textit{Eco}$RI sites ...
0 0 votes
0 0 answers
A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...
0 0 votes
0 0 answers
A recombinant protein is to be expressed under the control of the lac promoter and operator in a strain $\textit{E.coli}$ having the genotype lacI$^+$ crp$^+$ . Even in t...
0 0 votes
0 0 answers
Shown below id a plasmid vector (P) and an insert (Q). The insert was cloned into the BamHI site of the vector. The recombinant plasmid was isolated and digested with Bam...
0 0 votes
0 0 answers
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 0 votes
0 0 answers
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...
0 0 votes
0 0 answers
Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice
0 0 votes
0 0 answers
Which one of the following features is NOT required in a prokaryotic expression vector?$\textit{oriC}$Selection markerCMV promoterRibosome binding site
0 0 votes
0 0 answers
In DNA sequencing reactions using the chain termination method, the ratio of ddNTPs to dNTPs should be$0$$< 1$$1$$>1$
0 0 votes
0 0 answers
Choose the appropriate pair of primers to amplify the following DNA fragment by the polymerase chain reaction (PCR).$$\textrm{5’ – GACCTGTGG- – – – – – – – – – – – – – – ...
0 0 votes
0 0 answers
A linear double stranded DNA of length $8$ kbp has three restriction sites. Each of these can either be a $\textit{Bam}\text{HI}$ or a $\textit{Hae}III$ site. The DNA was...
0 0 votes
0 0 answers
The 4-amino or 4-keto group of pyrimidine bases is located in themajor groove of the double stranded DNAminor groove of the double stranded DNAminor groove of the B form ...