Register
Filter

Hot questions in Others

0 votes
0 answers
441
GATE2015-15
The Cytokinetic organelle in plant cells is centriole Phragmoplast proplastid chromoplastid
The Cytokinetic organelle in plant cells iscentriolePhragmoplastproplastidchromoplastid
0 votes
0 answers
442
GATE2015-63
Samples of bacterial culture taken at $5$ PM and then the next day at $5$ AM were found to have $10^4$ and $10^7$ cells.mL${-1}$, respectively. Assuming that both the samples were taken during the log phase of cell growth, the generation time of this bacterium will be ________$h$.
Samples of bacterial culture taken at $5$ PM and then the next day at $5$ AM were found to have $10^4$ and $10^7$ cells.mL${-1}$, respectively. Assuming that both the sam...
0 votes
0 answers
443
GATE2015-50
Match the antibiotics in $\text{Group I}$ with their modes of action in $\text{Group II}$ ... $\text{P-3, Q-2, R-1, S-4}$ $\text{P-1, Q-4, R-3, S-2}$
Match the antibiotics in $\text{Group I}$ with their modes of action in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \text{Group I} && \text{Group II} \\ \hline ...
0 votes
0 answers
444
GATE2015-37
How many rooted and unrooted phylogenetic trees, respectively, are possible with four different sequences? $3$ and $15$ $15$ and $3$ $15$ and $12$ $12$ and $3$
How many rooted and unrooted phylogenetic trees, respectively, are possible with four different sequences?$3$ and $15$$15$ and $3$$15$ and $12$$12$ and $3$
0 votes
0 answers
446
GATE2017-30
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below: Choose the correct combination. $P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{ and } R: \text{Random coil}$ ... $P: \beta- \text{Random coil}, Q: \alpha- \text{helix}, \text{ and }R: \text{sheet}$
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below:Choose the correct combination.$P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{...
0 votes
0 answers
449
GATE2016-39
Which one of the following statements regarding G proteins is INCORRECT? GDP is bound to G protein in the resting stage GTP bound $\alpha$ subunit cannot reassemble with $\beta \gamma$ dimer All G proteins are trimeric Activation of G protein may result in activation or inhibition of the target enzymes
Which one of the following statements regarding G proteins is INCORRECT?GDP is bound to G protein in the resting stageGTP bound $\alpha$ subunit cannot reassemble with $\...
0 votes
0 answers
452
GATE2015-22
The determinant of the matrix $\begin{bmatrix} 3 & 0 & 0 \\ 2 & 5 & 0 \\ 6 & -8 & -4 \end{bmatrix}$ is __________
The determinant of the matrix $\begin{bmatrix} 3 & 0 & 0 \\ 2 & 5 & 0 \\ 6 & -8 & -4 \end{bmatrix}$ is __________
0 votes
0 answers
453
GATE2017-41
The genome is diploid at the end of which phases of a human mitotic cell cycle? $\text{G2 & S}$ $\text{G1 & M}$ $\text{M & S}$ $\text{G1 & G2}$
The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$
0 votes
0 answers
454
GATE2015-31
Which one of the following graphs represents uncompetitive inhibition?
Which one of the following graphs represents uncompetitive inhibition?
0 votes
0 answers
456
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
457
GATE2017-40
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over time?
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...
0 votes
0 answers
458
GATE2012-24
The molarity of water in a water : ethanol mixture ($15 : 85$, v/v) is approximately $0.85$ $5.55$ $8.5$ $55.5$
The molarity of water in a water : ethanol mixture ($15 : 85$, v/v) is approximately$0.85$$5.55$$8.5$$55.5$
0 votes
0 answers
459
GATE2015-27
Which one of the following relations holds true for the specific growth rate $(\mu)$ of a microorganism in the death phase? $\mu=0$ $\mu<0$ $\mu=\mu_{\text{max}}$ $0<\mu<\mu_{\text{max}}$
Which one of the following relations holds true for the specific growth rate $(\mu)$ of a microorganism in the death phase?$\mu=0$$\mu<0$$\mu=\mu_{\text{max}}$$0<\mu<\mu_...
0 votes
0 answers
460
GATE2015-23
Which one of the following features is NOT required in a prokaryotic expression vector? $\textit{oriC}$ Selection marker CMV promoter Ribosome binding site
Which one of the following features is NOT required in a prokaryotic expression vector?$\textit{oriC}$Selection markerCMV promoterRibosome binding site
0 votes
0 answers
461
GATE2015-14
Based on the heavy chain, which one of the following antibodies has multiple subtypes? IgM IgD IgE IgG
Based on the heavy chain, which one of the following antibodies has multiple subtypes?IgMIgDIgEIgG
0 votes
0 answers
462
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
463
GATE2017-18
In eukaryotes, cytokinesis is inhibited by cytochalasin D vinblastine nocodazole colchicine
In eukaryotes, cytokinesis is inhibited bycytochalasin Dvinblastinenocodazolecolchicine
0 votes
0 answers
465
GATE2014-39
Match the following plant sources with their secondary metabolites and medical uses: ... $\text{P-1-b, Q-4-c, R-2-d, S-3-a}$
Match the following plant sources with their secondary metabolites and medical uses:$\begin{array}{|l|l|l|} \hline \textbf{Source plant} & \textbf{Secondary metabolites} ...
0 votes
0 answers
466
GATE2015-55
A heterozygous tall plant $(Tt)$ was crossed with a homozygous dwarf plant $(tt)$. The resultant seeds were collected. If five seeds are chosen at random, then the probability (in $\%$) that exactly two of these seeds will yiIeld dwarf plants is __________
A heterozygous tall plant $(Tt)$ was crossed with a homozygous dwarf plant $(tt)$. The resultant seeds were collected. If five seeds are chosen at random, then the probab...
0 votes
0 answers
467
GATE2015-47
Match the reagents in $\text{Group I}$ with their preferred cleavage sites in $\text{Group II}$ ... $\text{P-1, Q-2, R-5, S-4}$ $\text{P-4, Q-2, R-5, S-3}$
Match the reagents in $\text{Group I}$ with their preferred cleavage sites in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \text{Group I} && \text{Group II} \\ \...
0 votes
0 answers
468
GATE2017-29
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$ ... $\text{P-,2 Q-3, R-1, S-4}$ $\text{P-4, Q-3, R-1, S-2}$ $\text{P-2, Q-3, R-4, S-1}$
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...
0 votes
0 answers
471
GATE2015-45
Match the microorganism in $\text{Group I}$ with their fermentation products in $\text{Group II}$ ... $\text{P-3, Q-4, R-1, S-2}$ $\text{P-3, Q-4, R-2, S-1}$
Match the microorganism in $\text{Group I}$ with their fermentation products in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} && \textbf{Group II}...
0 votes
0 answers
472
GATE2015-17
ABO blood group antigens in humans are differentiated from each other on the basis of sialic acid lipids spectrin glycoproteins
ABO blood group antigens in humans are differentiated from each other on the basis ofsialic acidlipidsspectringlycoproteins
0 votes
0 answers
473
GATE2015-16
Anergy refers to nitochondrial dysfunction allergy to environmental antigens unresponsiveness to antigens a state of no energy
Anergy refers tonitochondrial dysfunctionallergy to environmental antigens unresponsiveness to antigensa state of no energy
0 votes
0 answers
474
GATE2015-13
Which one of the following is a second generation genetically engineered crop? Bt brinjal Roundup soyabean Golden rice Bt rice
Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice
0 votes
0 answers
475
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
476
GATE2017-26
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentration of free protein in solution
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...
0 votes
0 answers
477
GATE2014-11
Since mammalian cells are sensitive to shear, scale-up of a mammalian cell process must consider, among other parameters, the following $\text{(given N=rotations/time, D=diameter of impeller)}$ $\pi ND$ $\pi N^2D$ $\pi ND^2$ none of these
Since mammalian cells are sensitive to shear, scale-up of a mammalian cell process must consider, among other parameters, the following $\text{(given N=rotations/time, D=...
0 votes
0 answers
478
GATE2015-29
How many different protein sequences of $100$ residues can be generated using $20$ standard amino acids? $100^{20}$ $100 \times 20$ $20^{100}$ $100! \times 20!$
How many different protein sequences of $100$ residues can be generated using $20$ standard amino acids?$100^{20}$$100 \times 20$$20^{100}$$100! \times 20!$
0 votes
0 answers
480
GATE2014-14
A bacterium belonging to cocci group has a diameter of $2\:\mu m.$ The numerical value of the ratio of its surface area to volume (in $\mu m^{-1}$) is _______.
A bacterium belonging to cocci group has a diameter of $2\:\mu m.$ The numerical value of the ratio of its surface area to volume (in $\mu m^{-1}$) is _______.
Page: