search
Log In
Welcome to GATE BioTechnology, where you can ask questions and receive answers from other members of the community.

Recent questions tagged gate2012

0 votes
0 answers
1
Q65 A political part)r orders an arch for the entrance to the ground in which the annual convention isbeing held. The prole of the arch follows the equation y = 2x 0.1x where y is the height of thearch in meters. The maximum possible height of the arch is 8 meters 10 meters 12 meters 14 meters
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
2
Q 64 An automobile plant contracted to bUV shock absorbers from No suppliers X and Y- X supplies60% and Y supplies 4090 of the shock absorbers All shock absorbers are subjected to a quality test.The ones that pass the quality test are considered reliable. Of X s shock ... probability that a randomly chosen shock absorber, which is found to be reliable, is made by Y15 0.288 0334 0.667 0.720
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
3
Q.63 Which of the following assertions are CORRECT?P: Adding 7 to each entry in a list adds 7 to the mean of the listQ: Adding 7 to each entry in a list adds 7 to the standard deviation of the listR: Doubling each entry' in a list doubles the mean of the listS: Doubling each entry in a list leaves the standard deviation of the list unchanged P: Q Q, R P, R R. S
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
4
Q62 Given the sequence of tenns, AD CG FK JP, the next term is 0\' ow P\' PW
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
5
Q.6l "anted Temporary, Part-time persons for the post of Field Interviewer to conduct personalinterviews to collect and collate economic data. Requirements: High School-pass, must beavailable for Day, Evening and Saturday work. Transportation paid, ... best inference from the above advertisement? Gender-discriminator)r Xenophobic Not designed to make the post attractive Not gender-discriminatory
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
6
Q58 Choose the grammatically INCORRECT sentence: They gave us the money back less the service charges of Three Hundred rupees. This countrys expenditure is not less than that of Bangladesh. The committee initially asked for a funding of Fifty Lakh rupees, but later settled for a lessersum. This countrys expenditure on educational reforms is very less.
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
7
Q60 Choose the most appropriate alternative from the options given below to complete the followingsentence:Despite several the mission succeeded in its attempt to resolve the conict. attempts setbacks meetings delegations
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
8
Q59 Which one of the following options is the closest in meaning to the word given below?Mitigate Diminish Dinilge Dedicate Denote
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
9
Q55 The feed ow rate required for the above biocom'ersion will be 50 111" 55 111 137 1111 550 lb"
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
10
Statement for Linked Answer Questions 54 and 55:B-Galactosidase bound to DEAE-cellulose is used to hydrolyze lactose to glucose and galactose in a plugow bioreactor mm a packed bed of volume 100 liters and a voidage (e) of 0.55. The Km and V'm; for theimmobilized enzyme are 0.72 ... be ignored.Q54 The residence time required for the steady state reactor operation will be 0.1 h 0.4 h 1.0 h 1.1 h
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
11
Q.51 The yield (9-6) for each step is P-lO, Q-7.2, R4.5= 8-2.0 P-34= Q-24, RlS, Sl P-3.4, Q-T4, R1.5, 8-0.1 P-lOO, Q-71, R44, 8-29
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
12
Common Data for Questions 50 and 51:The purication data for an enzyme is given below:Step Total protein Total activity Specific activity- nits Units-m)Cellfree extract 177 102 0.58O- Seharose 18.8 72 3.83Phenvl Seoharose 9.2 45 4.89ehacrvl 8-200 4.1 30 7.32 Q.50 The fold purification for each step is P-0.1= Q- 0.66 ... .26 P-1.0, Q-O.52= RO.67, 5-0.8 Pl. Q-6.6= R-8.4, Sl2-6 P-lOO= Q-66, R-84. S-12
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
13
Q56 The cost function for a product in a rm is given by 5g}: where q is the amount of production. Therm can sell the product at a market price of ? 50 per unit. The number of units to be produced bythe rm such that the prot is maximized is 5 10 15 25
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
14
Q57 Choose the most appropriate alternative from the options given below to complete the followingsentence:Sureshs dog is the one was hurt in the stampede. that which who whom
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
15
Q.53 Therefore the lac-operon is repressed and can only be induced with lactose. repressed and cannot be induced with lactose. not repressed. expressed only when glucose and lactose are present.
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
16
Statement for Linked Answer Questions 52 and 53:An E coli cell of 8volume 1091 cm3 contains 60 molecules of lac-repressor The repressor has a bindingafnity (Kd) of 10'8 M and 10'9 M \\ 1th and mthout lactose respectn ely. in the mediumQ52 The molar concentration of the repressor in the cell 15 0.1 nM 1 nM 10 nM 100 nM
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
17
Q44 Match the vitamins in Group I with the processesv'ieactions in Group II.Group I Group IIP. Pantothenic acid 1. Electron transponQ. Vitamin B9. 2. Transfer of l-C unitsR. Vitamin B 3. DecarboxylationS. Folic acid 4. Fatty acid metabolism5. Hydrolysis P-S, Q-z, R-4, 3-1 M, Q-l, R3, -2 P-4, Qn, R-l, 3-3 P-2, Q-l, R-3, s-s
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
18
Common Data QuestionsCommon Data for Questions 48 and 49 :In a muscle, the extracellular and intracellular concentrations of Na are 150 mM and 12 mM, and those ofK are 2.7 mM and 140 mM respectively. Assume that the temperature is 25C and that the membranepotential is -60 m\': with the interior ... for the transport of three Na out of the cell is +1.5 kJ.-"mol +174 kJr'mol +18.9 kl-mol +363 kl-mol
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
19
Q47 A bacterial culture (200 pl containing 1.8 X 109 cells) was treated with an antibiotic Z (50 pgper ml) for 4 h at 3 70 After this treatment, the culture was divided into two equal aliquots.Set A: 100 pl was plated on Luria agar.Set ... no colonies, whereas theSet B plate showed 0.9 X 10 cells. This experiment showed that the antibiotic Z is bacteriostatic bacteriocidal bacteriolytic apoptotic
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
20
Q43 Match the high energy compounds in Group I with the bioswnhetic pathways for the molecules inGroup II.Groug I Groug IIP. GTP 1. Fatty acidQ. UTP 2. PhospholipidR. CTP 3. Protein8. Acyl coenzyme A 4. Peptidoglycan P-3, Q9, R-4, 5-1 P-2, Q4, R-3= S-l P-4, Q-3, R-l, 8-2 P-3, Q-4, R-l S-l
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
21
Q45 Consider the data set 14, 18, 14, 14, 10, 29, 33, 31, 25. Ifyou add 20 to each of the values, then both mean and variance change both mean and variance are unchanged the mean is unchanged, variance changes the mean changes, the variance is unchanged
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
22
Q46 An enzymatic reaction is described by the following rate expressionv = Lkm +s+s s'k,Which one of the following cun'es represents this expression? s L S Lv v S L S Lv v
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
23
Q49 The free energy change for the transport of two K* into the cell is +8.0 kl-mol +11.6 kl-mol +196 kamol +312. kJs'mol
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
24
Q41 Match the organisms in Group I with the entries in Group II.Groug IP. ClostridiumQ. EscherichiaR VibrioS. Bacillus(A) M, Q-4, R-S, 5-1(C) P-S, Q-4, 11-2: 5-3Groug II1.2.3.45.Rods with teichoic acid in the cell wallRods with endosporesHelical rods with agellaRods with LPS in the outer membraneCurved rods with polar agella(B) P-2, QL 11-5: 34(D) P-3, on, RL 54
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
25
Q40 A disease is inherited by a child with a probability of 1:4. In a family with two children, theprobability that exactly one sibling is affected by this disease is 1.54 3-8 7316 9.16
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
26
Q39 Determine the correctness or otherwise of the following Assertion (a) and Reason (1').Assertion: Cell mass yield of a methylotrophic yeast is more on methanol compared to glucose.Reason: Methanol has a greater degree of reductance compared to glucose.(A) Both (a) and (r) are correct and (r ... (a) is false, (r) is correct Both (a) and (r) are correct but (r) is not the correct reason for (a)
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
27
Q38 Match the dovmstream processes in Group I with the products in Group II.Group I Group IIP. Solvent extraction 1. Lactic acidQ. Protein-A linked ainity chromatography 2. PenicillinR. Extractive distillation 3. Monoclonal antibodyS. Salting out 4. Lipase m, Q-3, R-l, 5-4 P4, Q-l, R-2= 33 P-4, Q-l, R-3, 5-2 P-2, Q-4, R-l= S-3
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
28
Q3 7 Match the entries in Group I with the process parameters in Group II.Group I Group IIP. Clark electrode 1. Liquid levelQ. Redox probe 2. Dissolved oxygen concentrationR. Load cell 3. Vessel pressureS. Diaphragm gauge 4. pH (anaerobic process) P-2, Q-l, R-3, 5-4 P-4, Q2, R-3. Sl P-2, Q-4, R-l, S-3 P-2, Q-l, R4= S-3
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
29
Q36 Determine the correctness or otherwise of the following Assertion (a) and Reason (r).Assertion: In direct somatic embryogenesis, embryos are developed uithout going through callusformation.Reason: This is possible due to the presence of pre-embryonically determined cells-(A) Both (a) and (r) are ... a) is true but (r) is false Both (a) and (r) are true and (r) is the correct reason for (a)
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
30
Q35 Determine the correctness or otherwise of the following Assertion (a) and Reason (r).Assertion: Plants convert fatty' acids into glucose.Reason: Plants have peroxisomes.(A) Both (a) and (r) are true but (r) is not the correct reason for Both (a) and (r) are true and (r) is the correct reason for (a) (a) is true but (r) is false (a) is false but (r) is true
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
31
Q42 Match the entries in Group I with the methods of sterilization in Group II.Groug IP. SerumQ. Luria brothR. Polypropylene tubesS. Biological safety cabinets(A) P-S, Q-3, R-l, 8-4(C) P-2, Q-l, R4, 5-3Groug IIAutoclaveMembrane ltrationUV irradiationGamma irradiationDry heat+92):U1(B) P-l, Q4, R-5= 3-3(D) P-4, Q-1,R3= s-s
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
32
Q.31 Match the terms in Group I with the ploidy in Group II.Groug I Groug IIP. Disome 1 2n + 1Q. Monosome 2. 2n lR Nullisome 3. n - 1S. Trisome 4 n + 1 M, Q-, R-3, 5-1 P4, Q3, Rl: s2 P-2, Q-3, R4: 54 P-l, Q-4, 113: 5-2
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
33
Q32 What is the rank of the folloudng matrix? o 1 5 3 16 2 4\14 10 o ?.\ / 3
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
34
Q33 Match the products in Group I with the applications in Group II.Group I Group IIP. Digoxin 1. Muscle relaxantQ. Stevioside 2 Anti-cancer agentR. Atropine 3. Cardiovascular disorderS. Vinblastine 4 Sweetener P-l, Q-4, R-3, 5-2 P-3, Q-2, R-L 34 P-3, Q-4, R-l, 5-2 P-2, Q-3, Rl= 8-4
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
35
Q34 Determine the correctness or otherwise of the following Assertion (a) and Reason (r).Assertion: The production of secondaryr metabolites in plant cell cultures is enhanced by theaddition of elicitors.Reason: Elicitors induce the expression of enzymes responsible for the biosynthesis ofsecondary metabolites.( ... correct reason for (a) (a) is true but (r) is false (a) is false but (r) is true
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
36
Q30 A single base pair of DNA weighs 1.1 X 10'21 grams. How many picomoles of a plasmid vector oflength 2750 bp are contained in 1 pg of puried DNA? 0.30 0.55 0.25 0.91
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
37
Q 29 In an exponentialh gro ing batch culture of Saccharormces cerex-isiae. the cell densitv is 20 gl 1(DCVV), the specic growth rate (11) 1s 0 4 h1 and substrate uptake rate (\) 1s 16 g1 1111 The cellyield coefcient Y x, mll be 0.32 0.64 0.80 0.50
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
38
Q28 Match the entries in Group I with those in Group II.Groug I Groug IIP. M'IT 1. Dihydrofolate reductaseQ. Armexin V 2. Succinate dehydrogenaseR. Methotrexate 3. MicrombulcsS. Taxol 4 Phosphatidylserine P-3, Q-l, R-4, 5-2- P-2, Q4, R-L 33 P-2, 0-3, R4, 8-] P-4, 0-2, R-l: S-3
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
39
Q.27 In zinc nger proteins, the amino acid residues that coordinate zinc are Cys and His Asp and (3111 Arg and Lys Asp and Arg
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
0 votes
0 answers
40
Q26 Which one of the following DNA sequences carries an invert repeat? ATGAGCCCCGAGTA ATGAGCCGGCTCTATACTCGGGGCTCAT TACTCGGCCGAGAT ATGAGCCGAGCCTA ATGAGCCTATGGTAACTCGGCTCGGAT TACTCGGATAC CAT
asked Mar 25, 2018 in Others Milicevic3306 7.9k points
...