Register
Filter

Most viewed questions in Others

0 votes
0 answers
481
GATE2015-17
ABO blood group antigens in humans are differentiated from each other on the basis of sialic acid lipids spectrin glycoproteins
ABO blood group antigens in humans are differentiated from each other on the basis ofsialic acidlipidsspectringlycoproteins
0 votes
0 answers
482
GATE2015-45
Match the microorganism in $\text{Group I}$ with their fermentation products in $\text{Group II}$ ... $\text{P-3, Q-4, R-1, S-2}$ $\text{P-3, Q-4, R-2, S-1}$
Match the microorganism in $\text{Group I}$ with their fermentation products in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} && \textbf{Group II}...
0 votes
0 answers
485
GATE2014-37
Consider a population of $10,000$ individuals, of which $2500$ are homozygotes (PP) and $3000$ are heterozygotes (Pp) genotype. The frequency of allele p in the population is_________.
Consider a population of $10,000$ individuals, of which $2500$ are homozygotes (PP) and $3000$ are heterozygotes (Pp) genotype. The frequency of allele p in the populatio...
0 votes
0 answers
489
GATE2012-7
Dimethyl sulfoxide (DMSO) is used as a cryopreservant for mammalian cell cultures because it is an organic solvent it easily penetrates cells it protects cells by preventing crystallization of water it is also utilized as a nutrient
Dimethyl sulfoxide (DMSO) is used as a cryopreservant for mammalian cell cultures becauseit is an organic solventit easily penetrates cellsit protects cells by preventing...
0 votes
0 answers
490
GATE2012-8
Nude mice refers to mice without skin mice without thymus knockout mice transgenic mice
Nude mice refers tomice without skinmice without thymusknockout micetransgenic mice
0 votes
0 answers
491
GATE BT 2024 | Question: 15
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway. only an anabolic only a catabolic an amphibolic a pyogenic
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway.only an anaboliconly a catabolic an amphibolica pyogenic
0 votes
0 answers
492
GATE BT 2024 | Question: 23
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.
0 votes
0 answers
493
GATE BT 2021 | Question: 35
Which of the following statement(s) is/are $\text{CORRECT}$ about $\textit{Agrobacterium tumefaciens}$? It contains tumor inducing plasmid It causes crown gall disease in dicotyledonous plants It is a Gram-positive soil bacterium It is used in generating transgenic plants
Which of the following statement(s) is/are $\text{CORRECT}$ about $\textit{Agrobacterium tumefaciens}$?It contains tumor inducing plasmidIt causes crown gall disease in d...
0 votes
0 answers
494
GATE2019: 40
Which of the following factors can influence the lag phase of a microbial culture in a batch fermentor? Inoculum size Inoculum age Medium composition $P$ and $Q$ only $Q$ and $R$ only $P$ and $R$ only $P, Q$ and $R$
Which of the following factors can influence the lag phase of a microbial culture in a batch fermentor?Inoculum sizeInoculum ageMedium composition$P$ and $Q$ only$Q$ and ...
0 votes
0 answers
495
GATE2020: 38
Match sub-cellular organelles listed in $Group\; I$ with their features listed in $Group\; II$ ... $P-2, Q-3, R-4, S-1$ $P-3, Q-4, R-2, S-1$ $P-3, Q-1, R-4, S-2$
Match sub-cellular organelles listed in $Group\; I$ with their features listed in $Group\; II$:$$\begin{array}{|cl|cI|cI|cI|cI|c|}\hline&\textbf{Group I} & \textbf{Group ...
0 votes
0 answers
496
GATE2020: 48
Assume that a cell culture was started with five human fibroblast cells. Two cells did not divide even once whereas the other three cells completed three rounds of cell division. At this stage, the total number of kinetochores in all the cells put together is ___________________.
Assume that a cell culture was started with five human fibroblast cells. Two cells did not divide even once whereas the other three cells completed three rounds of cell d...
0 votes
0 answers
498
GATE2015-29
How many different protein sequences of $100$ residues can be generated using $20$ standard amino acids? $100^{20}$ $100 \times 20$ $20^{100}$ $100! \times 20!$
How many different protein sequences of $100$ residues can be generated using $20$ standard amino acids?$100^{20}$$100 \times 20$$20^{100}$$100! \times 20!$
0 votes
0 answers
499
GATE2014-25
The growth medium for mammalian cells contains serum. One of the major functions of serum is to stimulate cell growth and attachment. However, it must be filter sterilized to remove large proteins remove collagen only remove mycoplasma and microorganisms remove foaming agents
The growth medium for mammalian cells contains serum. One of the major functions of serum is to stimulate cell growth and attachment. However, it must be filter sterilize...
0 votes
0 answers
500
GATE2012-4
Identification of blood groups involves precipitation neutralization opsonization agglutination
Identification of blood groups involvesprecipitationneutralizationopsonizationagglutination
0 votes
0 answers
502
GATE BT 2024 | Question: 40
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE? $5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$ It contains nine codons in the reading frame It contains ten codons in the reading frame It codes for eight amino acids It codes for nine amino acids
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...
0 votes
0 answers
503
GATE BT 2024 | GA Question: 2
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$ depends on $x y$ depends only on $x$ and not on $y$ depends only on $y$ and not on $x$ is a constant
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$depends on $x y$depends only on $x$ an...
0 votes
0 answers
505
GATE2017-29
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$ ... $\text{P-,2 Q-3, R-1, S-4}$ $\text{P-4, Q-3, R-1, S-2}$ $\text{P-2, Q-3, R-4, S-1}$
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...
0 votes
0 answers
507
GATE2015-25
Which one of the following is INCORRECT about a typical apoptotic cell? Phosphatidylserine is presented on the outer cell surface Cytochrome c is released from mitochondria Mitochondrial membrane potential does not change Annexin-V binds to the cell surface
Which one of the following is INCORRECT about a typical apoptotic cell?Phosphatidylserine is presented on the outer cell surfaceCytochrome c is released from mitochondria...
0 votes
0 answers
511
GATE2012-25
The helix content of a protein can be determined using an infrared spectrometer a fluorescence spectrometer a circular dichroism spectrometer a UV-Visible spectrophotometer
The helix content of a protein can be determined usingan infrared spectrometera fluorescence spectrometera circular dichroism spectrometera UV-Visible spectrophotometer
0 votes
0 answers
512
GATE2012-6
A humanized antibody is one in which the heavy and light chains are from human heavy chain is from human and light chain is from mouse light chain is from human and heavy chain is from mouse CDRs are from mouse, and the rest is from human
A humanized antibody is one in which theheavy and light chains are from humanheavy chain is from human and light chain is from mouselight chain is from human and heavy ch...
0 votes
0 answers
513
GATE2017-26
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentration of free protein in solution
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...
0 votes
0 answers
514
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
515
GATE2015-24
Production of monoclonal antibodies by hybridoma technology requires splenocytes osteocytes hepatocytes thymocytes
Production of monoclonal antibodies by hybridoma technology requiressplenocytesosteocyteshepatocytesthymocytes
0 votes
0 answers
516
GATE2014-55
The active site in the alpha/beta barrel structures is usually located inside the barrel at the amino side of the strands at the carboxy side of the strands at any arbitrary site
The active site in the alpha/beta barrel structures is usually locatedinside the barrelat the amino side of the strandsat the carboxy side of the strandsat any arbitrary ...
0 votes
0 answers
518
GATE BT 2024 | Question: 9
During normal embryonic development of the mice paw, elimination of cells from the inter-digital space is due to $\_\_\_\_\_\_\_$. apoptosis meiosis mutagenesis necrosis
During normal embryonic development of the mice paw, elimination of cells from the inter-digital space is due to $\_\_\_\_\_\_\_$.apoptosismeiosismutagenesisnecrosis
0 votes
0 answers
519
GATE BT 2024 | Question: 18
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$. $1$ $2$ $3$ $4$
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$.$1$$2$$3$$4$
0 votes
0 answers
520
GATE2020: 14
Which of the following are energy transducing membranes? Plasma membrane of bacteria Inner membrane of chloroplasts Inner membrane of mitochondria $P$ and $Q$ only $P$ and $R$ only $Q$ and $R$ only $P, Q$ and $R$
Which of the following are energy transducing membranes?Plasma membrane of bacteriaInner membrane of chloroplastsInner membrane of mitochondria$P$ and $Q$ only$P$ and $R$...
Page: