Register
Filter

Most viewed questions

0 votes
0 answers
761
GATE BT 2021 | Question: 35
Which of the following statement(s) is/are $\text{CORRECT}$ about $\textit{Agrobacterium tumefaciens}$? It contains tumor inducing plasmid It causes crown gall disease in dicotyledonous plants It is a Gram-positive soil bacterium It is used in generating transgenic plants
Which of the following statement(s) is/are $\text{CORRECT}$ about $\textit{Agrobacterium tumefaciens}$?It contains tumor inducing plasmidIt causes crown gall disease in d...
0 votes
0 answers
762
GATE2019: 40
Which of the following factors can influence the lag phase of a microbial culture in a batch fermentor? Inoculum size Inoculum age Medium composition $P$ and $Q$ only $Q$ and $R$ only $P$ and $R$ only $P, Q$ and $R$
Which of the following factors can influence the lag phase of a microbial culture in a batch fermentor?Inoculum sizeInoculum ageMedium composition$P$ and $Q$ only$Q$ and ...
0 votes
0 answers
763
GATE2020: 38
Match sub-cellular organelles listed in $Group\; I$ with their features listed in $Group\; II$ ... $P-2, Q-3, R-4, S-1$ $P-3, Q-4, R-2, S-1$ $P-3, Q-1, R-4, S-2$
Match sub-cellular organelles listed in $Group\; I$ with their features listed in $Group\; II$:$$\begin{array}{|cl|cI|cI|cI|cI|c|}\hline&\textbf{Group I} & \textbf{Group ...
0 votes
0 answers
764
GATE2020: 48
Assume that a cell culture was started with five human fibroblast cells. Two cells did not divide even once whereas the other three cells completed three rounds of cell division. At this stage, the total number of kinetochores in all the cells put together is ___________________.
Assume that a cell culture was started with five human fibroblast cells. Two cells did not divide even once whereas the other three cells completed three rounds of cell d...
0 votes
0 answers
766
GATE2015-29
How many different protein sequences of $100$ residues can be generated using $20$ standard amino acids? $100^{20}$ $100 \times 20$ $20^{100}$ $100! \times 20!$
How many different protein sequences of $100$ residues can be generated using $20$ standard amino acids?$100^{20}$$100 \times 20$$20^{100}$$100! \times 20!$
0 votes
0 answers
768
GATE2014-25
The growth medium for mammalian cells contains serum. One of the major functions of serum is to stimulate cell growth and attachment. However, it must be filter sterilized to remove large proteins remove collagen only remove mycoplasma and microorganisms remove foaming agents
The growth medium for mammalian cells contains serum. One of the major functions of serum is to stimulate cell growth and attachment. However, it must be filter sterilize...
0 votes
0 answers
769
GATE2012-4
Identification of blood groups involves precipitation neutralization opsonization agglutination
Identification of blood groups involvesprecipitationneutralizationopsonizationagglutination
0 votes
0 answers
770
GATE BT 2024 | Question: 15
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway. only an anabolic only a catabolic an amphibolic a pyogenic
Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway.only an anaboliconly a catabolic an amphibolica pyogenic
0 votes
0 answers
771
GATE BT 2024 | GA Question: 2
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$ depends on $x y$ depends only on $x$ and not on $y$ depends only on $y$ and not on $x$ is a constant
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$depends on $x y$depends only on $x$ an...
0 votes
0 answers
772
GATE2017-29
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$ ... $\text{P-,2 Q-3, R-1, S-4}$ $\text{P-4, Q-3, R-1, S-2}$ $\text{P-2, Q-3, R-4, S-1}$
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...
0 votes
0 answers
774
GATE2015-25
Which one of the following is INCORRECT about a typical apoptotic cell? Phosphatidylserine is presented on the outer cell surface Cytochrome c is released from mitochondria Mitochondrial membrane potential does not change Annexin-V binds to the cell surface
Which one of the following is INCORRECT about a typical apoptotic cell?Phosphatidylserine is presented on the outer cell surfaceCytochrome c is released from mitochondria...
0 votes
0 answers
778
GATE2012-25
The helix content of a protein can be determined using an infrared spectrometer a fluorescence spectrometer a circular dichroism spectrometer a UV-Visible spectrophotometer
The helix content of a protein can be determined usingan infrared spectrometera fluorescence spectrometera circular dichroism spectrometera UV-Visible spectrophotometer
0 votes
0 answers
779
GATE2012-6
A humanized antibody is one in which the heavy and light chains are from human heavy chain is from human and light chain is from mouse light chain is from human and heavy chain is from mouse CDRs are from mouse, and the rest is from human
A humanized antibody is one in which theheavy and light chains are from humanheavy chain is from human and light chain is from mouselight chain is from human and heavy ch...
0 votes
0 answers
780
GATE BT 2024 | Question: 40
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE? $5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$ It contains nine codons in the reading frame It contains ten codons in the reading frame It codes for eight amino acids It codes for nine amino acids
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...
0 votes
0 answers
781
GATE2017-26
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentration of free protein in solution
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...
0 votes
0 answers
782
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
784
GATE2015-24
Production of monoclonal antibodies by hybridoma technology requires splenocytes osteocytes hepatocytes thymocytes
Production of monoclonal antibodies by hybridoma technology requiressplenocytesosteocyteshepatocytesthymocytes
0 votes
0 answers
785
GATE2014-55
The active site in the alpha/beta barrel structures is usually located inside the barrel at the amino side of the strands at the carboxy side of the strands at any arbitrary site
The active site in the alpha/beta barrel structures is usually locatedinside the barrelat the amino side of the strandsat the carboxy side of the strandsat any arbitrary ...
0 votes
0 answers
788
GATE2020: 14
Which of the following are energy transducing membranes? Plasma membrane of bacteria Inner membrane of chloroplasts Inner membrane of mitochondria $P$ and $Q$ only $P$ and $R$ only $Q$ and $R$ only $P, Q$ and $R$
Which of the following are energy transducing membranes?Plasma membrane of bacteriaInner membrane of chloroplastsInner membrane of mitochondria$P$ and $Q$ only$P$ and $R$...
0 votes
0 answers
792
GATE2015-53
Consider the following multiple sequence alignment of four DNA sequences. $\begin{array}{cccc} A & C & T & A \\ A & C & T & G \\ A & G & T & C \\ A & G & C & T \end{array}$Shannon's entropy of the above alignment is ___________
Consider the following multiple sequence alignment of four DNA sequences.$$\begin{array}{cccc} A & C & T & A \\ A & C & T & G \\ A & G & T & C \\ A & G & C & T \end{arra...
0 votes
0 answers
793
GATE2013-3
Protein A, which has strong affinity to $F_C$ region of immunoglobulin, is extracted from $\text{Saccharomyces cerevisiae}$ $\text{Staphylococcus aureus}$ $\text{Streptococcus pyogenes}$ $\text{Streptococcus sanguis}$
Protein A, which has strong affinity to $F_C$ region of immunoglobulin, is extracted from$\text{Saccharomyces cerevisiae}$$\text{Staphylococcus aureus}$$\text{Streptococc...
0 votes
0 answers
794
GATE BT 2024 | Question: 9
During normal embryonic development of the mice paw, elimination of cells from the inter-digital space is due to $\_\_\_\_\_\_\_$. apoptosis meiosis mutagenesis necrosis
During normal embryonic development of the mice paw, elimination of cells from the inter-digital space is due to $\_\_\_\_\_\_\_$.apoptosismeiosismutagenesisnecrosis
0 votes
0 answers
795
GATE BT 2024 | Question: 18
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$. $1$ $2$ $3$ $4$
A value of $k$ for which the linear equations $(k-1) x+3 y=0$ and $2 x+k y=0$ have a non-zero solution is $\_\_\_\_\_\_\_$.$1$$2$$3$$4$
0 votes
0 answers
798
GATE2019: 34
Antibody-producing hybridoma cells are generated by the fusion of a $T$ cell with a myeloma cell $B$ cell with a myeloma cell macrophage with a myeloma cell $T$ cell and a $B$ cell
Antibody-producing hybridoma cells are generated by the fusion of a$T$ cell with a myeloma cell$B$ cell with a myeloma cellmacrophage with a myeloma cell$T$ cell and a $B...
0 votes
0 answers
799
GATE2019: 36
Which one of the following covalent linkages exists between $7$-Methyl guanosine $(m^{7}G)$ and $mRNAs$? ${2}'-{3}'$ triphosphate ${3}'-{5}'$ triphosphate ${5}'-{5}'$ triphosphate ${2}'-{5}'$ triphosphate
Which one of the following covalent linkages exists between $7$-Methyl guanosine $(m^{7}G)$ and $mRNAs$?${2}'-{3}'$ triphosphate${3}'-{5}'$ triphosphate${5}'-{5}'$ tripho...
Page: