Register
Filter

Most viewed questions in Others

0 votes
0 answers
442
GATE2017-41
The genome is diploid at the end of which phases of a human mitotic cell cycle? $\text{G2 & S}$ $\text{G1 & M}$ $\text{M & S}$ $\text{G1 & G2}$
The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$
0 votes
0 answers
443
GATE2015-14
Based on the heavy chain, which one of the following antibodies has multiple subtypes? IgM IgD IgE IgG
Based on the heavy chain, which one of the following antibodies has multiple subtypes?IgMIgDIgEIgG
0 votes
0 answers
444
GATE2015-23
Which one of the following features is NOT required in a prokaryotic expression vector? $\textit{oriC}$ Selection marker CMV promoter Ribosome binding site
Which one of the following features is NOT required in a prokaryotic expression vector?$\textit{oriC}$Selection markerCMV promoterRibosome binding site
0 votes
0 answers
445
GATE2015-27
Which one of the following relations holds true for the specific growth rate $(\mu)$ of a microorganism in the death phase? $\mu=0$ $\mu<0$ $\mu=\mu_{\text{max}}$ $0<\mu<\mu_{\text{max}}$
Which one of the following relations holds true for the specific growth rate $(\mu)$ of a microorganism in the death phase?$\mu=0$$\mu<0$$\mu=\mu_{\text{max}}$$0<\mu<\mu_...
0 votes
0 answers
446
GATE2014-43
In an affine gap penalty model, if the gap opening penalty $-20$, gap extension penalty is $-4$ and gap length is $8$, the gap score is__________.
In an affine gap penalty model, if the gap opening penalty $-20$, gap extension penalty is $-4$ and gap length is $8$, the gap score is__________.
0 votes
0 answers
447
GATE2014-52
Which of the following statements with respect to the orientation of the nitrogenous bases to the pentose sugars, and the puckering of the sugar, is correct? Anti, and 2’-endo in A form DNA Anti, and 2’-endo in B form DNA Syn, and 3’-endo in A form DNA Syn, and 3’-endo in B form DNA
Which of the following statements with respect to the orientation of the nitrogenous bases to the pentose sugars, and the puckering of the sugar, is correct?Anti, and 2�...
0 votes
0 answers
448
GATE2013-25
In a batch culture, the specific rate of substrate utilization is $\text{0.25 g (g cell mass)}$^{-1} h^{-1}$ and specific rate of product formation is $\text{0.215 g (g cell mass)}$^{-1}h^{-1}$ . Calculate the yield of product from the substrate$(Y_{p/s})$._______________
In a batch culture, the specific rate of substrate utilization is $\text{0.25 g (g cell mass)}$$^{-1} h^{-1}$ and specific rate of product formation is $\text{0.215 g (g ...
0 votes
0 answers
449
GATE2012-42
Match the entries in $\text{Group I}$ with the methods of sterilization in $\text{Group II}$ ... $\text{P-1, Q-4, R-5, S-3}$ $\text{P-2, Q-1, R-4, S-3}$ $\text{P-4, Q-1, R-3, S-5}$
Match the entries in $\text{Group I}$ with the methods of sterilization in $\text{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} && \text{Group II} \\ \h...
0 votes
0 answers
450
GATE BT 2024 | Question: 1
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$. covalent bonds electrostatic interactions ionic bonds van der Waals forces
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$.covalent bondselectrostatic interac...
0 votes
0 answers
451
GATE BT 2024 | Question: 8
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule. $\text{C-N}$ $\text{N-O}$ $\text{S-C}$ $\text{S-S}$
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule.$\text{C-N}$ $\text{N-O}$$\text{S-C}$$\text{S-S...
0 votes
0 answers
452
GATE BT 2024 | Question: 42
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process? $\mathrm{pH}$ of the medium Osmolarity of the medium Substrate concentration in the medium Substrate feed rate
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...
0 votes
0 answers
453
GATE BT 2024 | GA Question: 10
The least number of squares to be added in the figure to make AB a line of symmetry is $6$ $4$ $5$ $7$
The least number of squares to be added in the figure to make AB a line of symmetry is$6$$4$ $5$ $7$
0 votes
0 answers
454
GATE BT 2021 | Question: 32
Which one of the following tools is used to compare all the possible six-open reading frames of a given nucleotide query sequence with all the available six-open reading frames of the nucleotide sequence database? $\text{BLASTN}$ $\text{BLASTX}$ $\text{TBLASTN}$ $\text{TBLASTX}$
Which one of the following tools is used to compare all the possible six-open reading frames of a given nucleotide query sequence with all the available six-open reading ...
0 votes
0 answers
456
GATE2019: 28
Match the organelles in $Group\; I$ with their function in $Group\; II$ ... $P-1, Q-4, R-5, S-3$ $P-2, Q-5, R-3, S-4$ $P-1, Q-3, R-4, S-5$
Match the organelles in $Group\; I$ with their function in $Group\; II$.$$\begin{array}&&\textbf{Group I} & \textbf{Group II} \\ &\text{P. Lysosome} & \text{1. Digestion...
0 votes
0 answers
457
GATE2019: 41
Which one of the following statements is $CORRECT$ about proportional controllers? The initial change in control output signal is relatively slow The initial corrective action is greater for larger error They have no offset There is no corrective action if the error is a constant
Which one of the following statements is $CORRECT$ about proportional controllers?The initial change in control output signal is relatively slowThe initial corrective act...
0 votes
0 answers
458
GATE2020: 39
Which of the following strategies are used by cells for metabolic regulation? Phosphorylation-dephosphorylation Allostery Feedback inhibition $P$ and $Q$ only $P$ and $R$ only $Q$ and $R$ only $P, Q$ and $R$
Which of the following strategies are used by cells for metabolic regulation?Phosphorylation-dephosphorylationAllosteryFeedback inhibition$P$ and $Q$ only$P$ and $R$ only...
0 votes
0 answers
462
GATE2012-16
Which one of the following is NOT a protoplast fusion inducing agent? Inactivated Sendai virus $Ca^{2+}$ at alkaline pH Polyethylene glycol Colchicine
Which one of the following is NOT a protoplast fusion inducing agent?Inactivated Sendai virus$Ca^{2+}$ at alkaline pHPolyethylene glycolColchicine
0 votes
0 answers
463
GATE BT 2024 | Question: 25
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will be $\_\_\_\_\_\_\_$ min (rounded off to $1$ decimal place).
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will ...
0 votes
0 answers
464
GATE2019: 37
Which one of the following amino acid residues will destabilize an $\alpha$-helix when inserted in the middle of the helix? Pro Val lIe Leu
Which one of the following amino acid residues will destabilize an $\alpha$-helix when inserted in the middle of the helix?ProVallIeLeu
0 votes
0 answers
465
GATE2020: 32
Some of the cytokinins used in plant tissue culture media are given below: $BAP$ Zeatin Kinetin $2iP$ Which of these are synthetic analogs? $P$ and $Q$ only $Q$ and $S$ only $R$ and $S$ only $P$ and $R$ only
Some of the cytokinins used in plant tissue culture media are given below:$BAP$ZeatinKinetin$2iP$Which of these are synthetic analogs?$P$ and $Q$ only$Q$ and $S$ only$R$ ...
0 votes
0 answers
466
GATE2017-40
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over time?
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...
0 votes
0 answers
467
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
468
GATE2015-47
Match the reagents in $\text{Group I}$ with their preferred cleavage sites in $\text{Group II}$ ... $\text{P-1, Q-2, R-5, S-4}$ $\text{P-4, Q-2, R-5, S-3}$
Match the reagents in $\text{Group I}$ with their preferred cleavage sites in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \text{Group I} && \text{Group II} \\ \...
0 votes
0 answers
469
GATE2015-55
A heterozygous tall plant $(Tt)$ was crossed with a homozygous dwarf plant $(tt)$. The resultant seeds were collected. If five seeds are chosen at random, then the probability (in $\%$) that exactly two of these seeds will yiIeld dwarf plants is __________
A heterozygous tall plant $(Tt)$ was crossed with a homozygous dwarf plant $(tt)$. The resultant seeds were collected. If five seeds are chosen at random, then the probab...
0 votes
0 answers
471
GATE2012-38
Match the downstream processes in $\text{Group I}$ with the products in $\text{Group II}$ ... $\text{P-4, Q-1, R-3, S-2}$ $\text{P-2, Q-4, R-1, S-3}$
Match the downstream processes in $\text{Group I}$ with the products in $\text{Group II}$.$\begin{array}{|C|l|C|l|} \hline& \textbf{Group I} & {} & \textbf{Group II} \\\h...
0 votes
0 answers
472
GATE2012-9
Heat inactivation of serum is done to inactivate prions mycoplasma complement pathogenic bacteria
Heat inactivation of serum is done to inactivateprionsmycoplasmacomplementpathogenic bacteria
0 votes
0 answers
475
GATE2019: 30
Which one of the following is coded by the $ABO$ blood group locus in the human genome? Acyl transferase Galactosyltransferase Transposase $\beta$-Galactosidase
Which one of the following is coded by the $ABO$ blood group locus in the human genome?Acyl transferaseGalactosyltransferaseTransposase$\beta$-Galactosidase
0 votes
0 answers
477
GATE2017-18
In eukaryotes, cytokinesis is inhibited by cytochalasin D vinblastine nocodazole colchicine
In eukaryotes, cytokinesis is inhibited bycytochalasin Dvinblastinenocodazolecolchicine
0 votes
0 answers
478
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
479
GATE2015-13
Which one of the following is a second generation genetically engineered crop? Bt brinjal Roundup soyabean Golden rice Bt rice
Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice
0 votes
0 answers
480
GATE2015-16
Anergy refers to nitochondrial dysfunction allergy to environmental antigens unresponsiveness to antigens a state of no energy
Anergy refers tonitochondrial dysfunctionallergy to environmental antigens unresponsiveness to antigensa state of no energy
Page: