Register
Filter

Recent questions in Others

0 votes
0 answers
402
GATE2017-24
A bacterium has a genome of size $6$ million base pairs. If the average rate of DNA synthesis is $1000$ base pairs/second, the time taken (in minutes) for replication of the genome will be ________.
A bacterium has a genome of size $6$ million base pairs. If the average rate of DNA synthesis is $1000$ base pairs/second, the time taken (in minutes) for replication of ...
0 votes
0 answers
403
GATE2017-25
At the transcription start site of a gene, any of the four nucleotides can occur with equal probability $p$. The Shannon Entropy $S$, given by $S= – \Sigma_{i=1}^4 p_i \ln p_i$, for this start site is _________
At the transcription start site of a gene, any of the four nucleotides can occur with equal probability $p$. The Shannon Entropy $S$, given by $S= – \Sigma_{i=1}^4 p_i ...
0 votes
0 answers
404
GATE2017-26
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentration of free protein in solution
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...
0 votes
0 answers
406
GATE2017-29
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$ ... $\text{P-,2 Q-3, R-1, S-4}$ $\text{P-4, Q-3, R-1, S-2}$ $\text{P-2, Q-3, R-4, S-1}$
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...
0 votes
0 answers
407
GATE2017-30
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below: Choose the correct combination. $P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{ and } R: \text{Random coil}$ ... $P: \beta- \text{Random coil}, Q: \alpha- \text{helix}, \text{ and }R: \text{sheet}$
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below:Choose the correct combination.$P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{...
0 votes
0 answers
408
GATE2017-31
Match the organisms in $\text{Column I}$ with the characteristics in $\text{Column II}$ ... $\text{P-2, Q-1, R-4, S-3}$ $\text{P-4, Q-1, R-2, S-3}$
Match the organisms in $\text{Column I}$ with the characteristics in $\text{Column II}$:$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \textbf{Column II} \\ \hli...
0 votes
0 answers
409
GATE2017-32
Which one of the following amino acids has three ionizable groups? Glycine Leucine Valine Lysine
Which one of the following amino acids has three ionizable groups?GlycineLeucineValineLysine
0 votes
0 answers
411
GATE2017-34
The concentration (in micromolar) of NADH in a solution with $A_{340}=0.50$ is _________ Given data: Path length $=1$ cm; Molar extinction coefficient of NADH $\varepsilon_{340}= 6220 M^{-1}cm^{-1}$
The concentration (in micromolar) of NADH in a solution with $A_{340}=0.50$ is _________Given data: Path length $=1$ cm; Molar extinction coefficient of NADH $\varepsilon...
0 votes
0 answers
412
GATE2017-35
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ion-exchange chromatography. The fold purification is ________
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ...
0 votes
0 answers
413
GATE2017-36
Which one of the following organisms is responsible for crown gall disease in plants? $\textit{Xanthomonas campestris}$ $\textit{Rhizobium etli}$ $\textit{Agrobacterium tume faciens}$ $\textit{Erwinia stewartii}$
Which one of the following organisms is responsible for crown gall disease in plants?$\textit{Xanthomonas campestris}$$\textit{Rhizobium etli}$$\textit{Agrobacterium tume...
0 votes
0 answers
414
GATE2017-38
Match the plant hormones in $\textbf{Column I}$ with functions in $\textbf{Column II}$ ... $\text{P-3, Q-1, R-2, S-4}$ $\text{P-2, Q-1, R-4, S-3}$
Match the plant hormones in $\textbf{Column I}$ with functions in $\textbf{Column II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \text{Column II} \\ \hline ...
0 votes
0 answers
416
GATE2017-40
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over time?
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...
0 votes
0 answers
417
GATE2017-41
The genome is diploid at the end of which phases of a human mitotic cell cycle? $\text{G2 & S}$ $\text{G1 & M}$ $\text{M & S}$ $\text{G1 & G2}$
The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$
0 votes
0 answers
420
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
421
GATE2017-45
A pedigree of an inheritable disease is shown below. This inheritable disease is $X$-linked dominant $X$-linked recessive or Y-linked only $Y$-linked only $X$-linked recessive
A pedigree of an inheritable disease is shown below.This inheritable disease is$X$-linked dominant$X$-linked recessive or Y-linkedonly $Y$-linkedonly $X$-linked recessive...
0 votes
0 answers
422
GATE2017-46
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________ Given data: Atomic weights $(Da)$ of $C=12, H=1, O=16, N=14$, and $S=32$.
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________Given data: Atomic ...
0 votes
0 answers
424
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
425
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
426
GATE2017-51
EcoRI restriction sites on a $10$ kb DNA fragment are shown below. Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained? $2,3,4,5,6,7,8$, and $10$ $2,3,4,5,6,$ and $7$ $2,3,4,$ and $7$ $2$ and $3$
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...
0 votes
0 answers
427
GATE2017-52
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______ Given data: $\pi = 3.14$
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______Given da...
0 votes
0 answers
429
GATE2017-54
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$ ... , the ethanol produced (in grams) is ________ Given data: Atomic weights (Da) of $C=12, H=1, O=16$, and $N=14$
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$. Every mole of carbon present in glu...
0 votes
0 answers
430
GATE2017-55
Which of the following conditions promote the development of human autoimmune disorders? Inability to eliminate self-reactive lymphocytes Generation of auto-antibodies Ability to eliminate self-reactive T-cells Induction of regulatory T-cells in the thymus P,R Q,S P,Q R,S
Which of the following conditions promote the development of human autoimmune disorders?Inability to eliminate self-reactive lymphocytesGeneration of auto-antibodiesAbili...
0 votes
0 answers
431
GATE2015-11
Which one of the following complement proteins is the initiator of the membrane attack complex $C3a$ $C3b$ $C5a$ $C5b$
Which one of the following complement proteins is the initiator of the membrane attack complex$C3a$$C3b$$C5a$$C5b$
0 votes
0 answers
432
GATE2015-12
Levinthal’s paradox is related to protein secretion protein degradation protein folding protein trafficking
Levinthal’s paradox is related toprotein secretionprotein degradationprotein foldingprotein trafficking
0 votes
0 answers
433
GATE2015-13
Which one of the following is a second generation genetically engineered crop? Bt brinjal Roundup soyabean Golden rice Bt rice
Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice
0 votes
0 answers
434
GATE2015-14
Based on the heavy chain, which one of the following antibodies has multiple subtypes? IgM IgD IgE IgG
Based on the heavy chain, which one of the following antibodies has multiple subtypes?IgMIgDIgEIgG
0 votes
0 answers
435
GATE2015-15
The Cytokinetic organelle in plant cells is centriole Phragmoplast proplastid chromoplastid
The Cytokinetic organelle in plant cells iscentriolePhragmoplastproplastidchromoplastid
0 votes
0 answers
436
GATE2015-16
Anergy refers to nitochondrial dysfunction allergy to environmental antigens unresponsiveness to antigens a state of no energy
Anergy refers tonitochondrial dysfunctionallergy to environmental antigens unresponsiveness to antigensa state of no energy
0 votes
0 answers
437
GATE2015-17
ABO blood group antigens in humans are differentiated from each other on the basis of sialic acid lipids spectrin glycoproteins
ABO blood group antigens in humans are differentiated from each other on the basis ofsialic acidlipidsspectringlycoproteins
0 votes
0 answers
438
GATE2015-18
Which one of the following organisms is used for the determination of phenol coefficient of a disinfectant? Salmonella typhi Escherichia coli Candida albicans Bacillus psychrophilus
Which one of the following organisms is used for the determination of phenol coefficient of a disinfectant?Salmonella typhiEscherichia coliCandida albicansBacillus psychr...
0 votes
0 answers
439
GATE2015-19
A single subunit enzyme converts $420$ $\mu$moles of substrate to product in one minute. The activity of the enzyme is ________ $\times 10^{-6}$ Kalal.
A single subunit enzyme converts $420$ $\mu$moles of substrate to product in one minute. The activity of the enzyme is ________ $\times 10^{-6}$ Kalal.
0 votes
0 answers
440
GATE2015-20
Which one of the following amino acids has the highest probability to be found on the surface of a typical globular protein in aqueous environment? Ala Val Arg Ile
Which one of the following amino acids has the highest probability to be found on the surface of a typical globular protein in aqueous environment?AlaValArgIle
Page: