Register
Filter

Most viewed questions

0 votes
0 answers
721
GATE2013-8
Human genome sequencing project involved the construction of genomic library in bacterial artificial chromosome $pBR322$ bacteriophage $pcDNA3.1$
Human genome sequencing project involved the construction of genomic library inbacterial artificial chromosome$pBR322$bacteriophage$pcDNA3.1$
0 votes
0 answers
722
GATE2012-62
Given the sequence of terms, AD CG FK JP, the next term is OV OW PV PW
Given the sequence of terms, AD CG FK JP, the next term isOVOWPVPW
0 votes
0 answers
723
GATE2012-16
Which one of the following is NOT a protoplast fusion inducing agent? Inactivated Sendai virus $Ca^{2+}$ at alkaline pH Polyethylene glycol Colchicine
Which one of the following is NOT a protoplast fusion inducing agent?Inactivated Sendai virus$Ca^{2+}$ at alkaline pHPolyethylene glycolColchicine
0 votes
0 answers
724
GATE BT 2024 | Question: 1
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$. covalent bonds electrostatic interactions ionic bonds van der Waals forces
In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$.covalent bondselectrostatic interac...
0 votes
0 answers
725
GATE BT 2024 | Question: 8
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule. $\text{C-N}$ $\text{N-O}$ $\text{S-C}$ $\text{S-S}$
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule.$\text{C-N}$ $\text{N-O}$$\text{S-C}$$\text{S-S...
0 votes
0 answers
726
GATE BT 2024 | Question: 25
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will be $\_\_\_\_\_\_\_$ min (rounded off to $1$ decimal place).
The decimal reduction time of a microbe during sterilization at $120{ }^{\circ} \mathrm{C}$ with a first order thermal death rate constant of $1 \mathrm{~min}^{-1}$ will ...
0 votes
0 answers
727
GATE BT 2024 | Question: 39
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally? $2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acid Indole-$3$-butyric acid $1$-Naphthaleneacetic acid
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...
0 votes
0 answers
728
GATE2019: 37
Which one of the following amino acid residues will destabilize an $\alpha$-helix when inserted in the middle of the helix? Pro Val lIe Leu
Which one of the following amino acid residues will destabilize an $\alpha$-helix when inserted in the middle of the helix?ProVallIeLeu
0 votes
0 answers
730
GATE2017-40
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over time?
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...
0 votes
0 answers
731
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
732
GATE2017-56
She has a sharp tongue and it can occasionally turn ___________ hurtful left methodical Vital
She has a sharp tongue and it can occasionally turn ___________hurtfulleftmethodicalVital
0 votes
0 answers
733
GATE2015-47
Match the reagents in $\text{Group I}$ with their preferred cleavage sites in $\text{Group II}$ ... $\text{P-1, Q-2, R-5, S-4}$ $\text{P-4, Q-2, R-5, S-3}$
Match the reagents in $\text{Group I}$ with their preferred cleavage sites in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \text{Group I} && \text{Group II} \\ \...
0 votes
0 answers
734
GATE2015-55
A heterozygous tall plant $(Tt)$ was crossed with a homozygous dwarf plant $(tt)$. The resultant seeds were collected. If five seeds are chosen at random, then the probability (in $\%$) that exactly two of these seeds will yiIeld dwarf plants is __________
A heterozygous tall plant $(Tt)$ was crossed with a homozygous dwarf plant $(tt)$. The resultant seeds were collected. If five seeds are chosen at random, then the probab...
0 votes
0 answers
736
GATE2013-10
In nature, the horizontal gene transfer across bacteria is mediated by gene cloning followed by transformation conjugation and transformation conjugation only transformation only
In nature, the horizontal gene transfer across bacteria is mediated bygene cloning followed by transformationconjugation and transformationconjugation onlytransformation ...
0 votes
0 answers
737
GATE2013-4
The first humanized monoclonal antibody approved for the treatment of breast canceris Rituximab Cetuximab Bevacizumab Herceptin
The first humanized monoclonal antibody approved for the treatment of breast cancerisRituximabCetuximabBevacizumabHerceptin
0 votes
0 answers
738
GATE2012-38
Match the downstream processes in $\text{Group I}$ with the products in $\text{Group II}$ ... $\text{P-4, Q-1, R-3, S-2}$ $\text{P-2, Q-4, R-1, S-3}$
Match the downstream processes in $\text{Group I}$ with the products in $\text{Group II}$.$\begin{array}{|C|l|C|l|} \hline& \textbf{Group I} & {} & \textbf{Group II} \\\h...
0 votes
0 answers
740
GATE2012-9
Heat inactivation of serum is done to inactivate prions mycoplasma complement pathogenic bacteria
Heat inactivation of serum is done to inactivateprionsmycoplasmacomplementpathogenic bacteria
0 votes
0 answers
741
GATE BT 2024 | Question: 42
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process? $\mathrm{pH}$ of the medium Osmolarity of the medium Substrate concentration in the medium Substrate feed rate
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...
0 votes
0 answers
742
GATE2019: 30
Which one of the following is coded by the $ABO$ blood group locus in the human genome? Acyl transferase Galactosyltransferase Transposase $\beta$-Galactosidase
Which one of the following is coded by the $ABO$ blood group locus in the human genome?Acyl transferaseGalactosyltransferaseTransposase$\beta$-Galactosidase
0 votes
0 answers
744
GATE2020: 32
Some of the cytokinins used in plant tissue culture media are given below: $BAP$ Zeatin Kinetin $2iP$ Which of these are synthetic analogs? $P$ and $Q$ only $Q$ and $S$ only $R$ and $S$ only $P$ and $R$ only
Some of the cytokinins used in plant tissue culture media are given below:$BAP$ZeatinKinetin$2iP$Which of these are synthetic analogs?$P$ and $Q$ only$Q$ and $S$ only$R$ ...
0 votes
0 answers
745
GATE2017-18
In eukaryotes, cytokinesis is inhibited by cytochalasin D vinblastine nocodazole colchicine
In eukaryotes, cytokinesis is inhibited bycytochalasin Dvinblastinenocodazolecolchicine
0 votes
0 answers
746
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
747
GATE2015-5
If $\log_x (5/7) = -1/3$, then the value of $x$ is $343/125$ $125/343$ $-25/49$ $-49/25$
If $\log_x (5/7) = -1/3$, then the value of $x$ is$343/125$$125/343$$-25/49$$-49/25$
0 votes
0 answers
748
GATE2015-13
Which one of the following is a second generation genetically engineered crop? Bt brinjal Roundup soyabean Golden rice Bt rice
Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice
0 votes
0 answers
749
GATE2015-16
Anergy refers to nitochondrial dysfunction allergy to environmental antigens unresponsiveness to antigens a state of no energy
Anergy refers tonitochondrial dysfunctionallergy to environmental antigens unresponsiveness to antigensa state of no energy
0 votes
0 answers
750
GATE2015-17
ABO blood group antigens in humans are differentiated from each other on the basis of sialic acid lipids spectrin glycoproteins
ABO blood group antigens in humans are differentiated from each other on the basis ofsialic acidlipidsspectringlycoproteins
0 votes
0 answers
751
GATE2015-45
Match the microorganism in $\text{Group I}$ with their fermentation products in $\text{Group II}$ ... $\text{P-3, Q-4, R-1, S-2}$ $\text{P-3, Q-4, R-2, S-1}$
Match the microorganism in $\text{Group I}$ with their fermentation products in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} && \textbf{Group II}...
0 votes
0 answers
753
GATE2014-37
Consider a population of $10,000$ individuals, of which $2500$ are homozygotes (PP) and $3000$ are heterozygotes (Pp) genotype. The frequency of allele p in the population is_________.
Consider a population of $10,000$ individuals, of which $2500$ are homozygotes (PP) and $3000$ are heterozygotes (Pp) genotype. The frequency of allele p in the populatio...
0 votes
0 answers
757
GATE2012-8
Nude mice refers to mice without skin mice without thymus knockout mice transgenic mice
Nude mice refers tomice without skinmice without thymusknockout micetransgenic mice
0 votes
0 answers
758
GATE2012-7
Dimethyl sulfoxide (DMSO) is used as a cryopreservant for mammalian cell cultures because it is an organic solvent it easily penetrates cells it protects cells by preventing crystallization of water it is also utilized as a nutrient
Dimethyl sulfoxide (DMSO) is used as a cryopreservant for mammalian cell cultures becauseit is an organic solventit easily penetrates cellsit protects cells by preventing...
0 votes
0 answers
759
GATE BT 2024 | Question: 23
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.
The degree of reduction (reductance) for oxalic acid $\left(\mathrm{C}_2 \mathrm{H}_2 \mathrm{O}_4\right)$ is $\_\_\_\_\_\_$.
Page: