Register
Filter

Recent questions without answers

0 votes
0 answers
481
GATE2017-41
The genome is diploid at the end of which phases of a human mitotic cell cycle? $\text{G2 & S}$ $\text{G1 & M}$ $\text{M & S}$ $\text{G1 & G2}$
The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$
0 votes
0 answers
484
GATE2017-44
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme? GAATTC AGCT GCGGCCGC ATGCCT
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 votes
0 answers
485
GATE2017-45
A pedigree of an inheritable disease is shown below. This inheritable disease is $X$-linked dominant $X$-linked recessive or Y-linked only $Y$-linked only $X$-linked recessive
A pedigree of an inheritable disease is shown below.This inheritable disease is$X$-linked dominant$X$-linked recessive or Y-linkedonly $Y$-linkedonly $X$-linked recessive...
0 votes
0 answers
486
GATE2017-46
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________ Given data: Atomic weights $(Da)$ of $C=12, H=1, O=16, N=14$, and $S=32$.
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________Given data: Atomic ...
0 votes
0 answers
487
GATE2017-47
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
0 votes
0 answers
489
GATE2017-49
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ moles/liter, the time (in minutes) taken by the system before $A$ is exhausted in a $100$ liter reactor is _________
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 votes
0 answers
490
GATE2017-50
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ ... attract via van der Waals attraction. Which one of the following plots correctly represents the interaction energy between the above two particles>
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 votes
0 answers
491
GATE2017-51
EcoRI restriction sites on a $10$ kb DNA fragment are shown below. Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained? $2,3,4,5,6,7,8$, and $10$ $2,3,4,5,6,$ and $7$ $2,3,4,$ and $7$ $2$ and $3$
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...
0 votes
0 answers
492
GATE2017-52
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______ Given data: $\pi = 3.14$
A DNA strand of length $25$ nm wraps diametrically around the circumference of a spherical histone-octamer once. The radius (nm) of the histone-octamer is _______Given da...
0 votes
0 answers
494
GATE2017-54
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$ ... , the ethanol produced (in grams) is ________ Given data: Atomic weights (Da) of $C=12, H=1, O=16$, and $N=14$
During anaerobic growth, an organism converts glucose $(P)$ into biomass $(Q)$, ethanol $(R)$, acetaldehyde $(S)$, and glycerol $(T)$. Every mole of carbon present in glu...
0 votes
0 answers
495
GATE2017-55
Which of the following conditions promote the development of human autoimmune disorders? Inability to eliminate self-reactive lymphocytes Generation of auto-antibodies Ability to eliminate self-reactive T-cells Induction of regulatory T-cells in the thymus P,R Q,S P,Q R,S
Which of the following conditions promote the development of human autoimmune disorders?Inability to eliminate self-reactive lymphocytesGeneration of auto-antibodiesAbili...
0 votes
0 answers
496
GATE2017-56
She has a sharp tongue and it can occasionally turn ___________ hurtful left methodical Vital
She has a sharp tongue and it can occasionally turn ___________hurtfulleftmethodicalVital
0 votes
0 answers
497
GATE2017-57
I ________ made arrangements had I _________ informed earlier. could have, been would have, being had, have had been, been
I ________ made arrangements had I _________ informed earlier.could have, been would have, beinghad, havehad been, been
0 votes
0 answers
499
GATE2017-59
$40\%$ of deaths on city roads may be attributed to drunken driving. The number of degrees needed to represent this as a slice of a pie chart is $120$ $144$ $160$ $212$
$40\%$ of deaths on city roads may be attributed to drunken driving. The number of degrees needed to represent this as a slice of a pie chart is$120$$144$$160$$212$
0 votes
0 answers
504
GATE2017-64
There are $3$ Indians and $3$ Chinese in a group of $6$ people. How many subgroups of this group can we choose so that every subgroup has at least one Indian? $56$ $52$ $48$ $44$
There are $3$ Indians and $3$ Chinese in a group of $6$ people. How many subgroups of this group can we choose so that every subgroup has at least one Indian?$56$$52$$48$...
0 votes
0 answers
506
GATE2015-1
Choose the most appropriate word from the options given below to complete the following sentence. The principal presented the chief guest with a _________, as token of appreciation. momento memento momentum moment
Choose the most appropriate word from the options given below to complete the following sentence.The principal presented the chief guest with a _________, as token of app...
0 votes
0 answers
507
GATE2015-2
Choose the appropriate word/phrase, out of the four options given below, to complete the following sentence: Frogs _________ croak roar hiss patter
Choose the appropriate word/phrase, out of the four options given below, to complete the following sentence:Frogs _________croakroarhisspatter
0 votes
0 answers
508
GATE2015-3
Choose the word most similar in meaning to the given word: Educe Exert Educate Extract Extend
Choose the word most similar in meaning to the given word:EduceExertEducateExtractExtend
0 votes
0 answers
509
GATE2015-4
Operators $\square$, $\lozenge$ and $\rightarrow$ are defined by: $a \: \square \: b = \dfrac{a-b}{a+b}$; $a \: \lozenge \: b = \dfrac{a+b}{a-b}$; $a \rightarrow b = ab$. Find the value of $(66 \: \square \: 6) \rightarrow (66 \: \lozenge \: 6)$. $-2$ $-1$ $1$ $2$
Operators $\square$, $\lozenge$ and $\rightarrow$ are defined by: $a \: \square \: b = \dfrac{a-b}{a+b}$; $a \: \lozenge \: b = \dfrac{a+b}{a-b}$; $a \rightarrow b = ab$....
0 votes
0 answers
510
GATE2015-5
If $\log_x (5/7) = -1/3$, then the value of $x$ is $343/125$ $125/343$ $-25/49$ $-49/25$
If $\log_x (5/7) = -1/3$, then the value of $x$ is$343/125$$125/343$$-25/49$$-49/25$
0 votes
0 answers
514
GATE2015-9
A cube of side $3$ units is formed using a set of smaller cubes of side $1$ unit. Find the proportion of the number of faces of the smaller cubes visible to those which are NOT visible. $1:4$ $1:3$ $1:2$ $2:3$
A cube of side $3$ units is formed using a set of smaller cubes of side $1$ unit. Find the proportion of the number of faces of the smaller cubes visible to those which a...
0 votes
0 answers
516
GATE2015-11
Which one of the following complement proteins is the initiator of the membrane attack complex $C3a$ $C3b$ $C5a$ $C5b$
Which one of the following complement proteins is the initiator of the membrane attack complex$C3a$$C3b$$C5a$$C5b$
0 votes
0 answers
517
GATE2015-12
Levinthal’s paradox is related to protein secretion protein degradation protein folding protein trafficking
Levinthal’s paradox is related toprotein secretionprotein degradationprotein foldingprotein trafficking
0 votes
0 answers
518
GATE2015-13
Which one of the following is a second generation genetically engineered crop? Bt brinjal Roundup soyabean Golden rice Bt rice
Which one of the following is a second generation genetically engineered crop?Bt brinjalRoundup soyabeanGolden riceBt rice
0 votes
0 answers
519
GATE2015-14
Based on the heavy chain, which one of the following antibodies has multiple subtypes? IgM IgD IgE IgG
Based on the heavy chain, which one of the following antibodies has multiple subtypes?IgMIgDIgEIgG
0 votes
0 answers
520
GATE2015-15
The Cytokinetic organelle in plant cells is centriole Phragmoplast proplastid chromoplastid
The Cytokinetic organelle in plant cells iscentriolePhragmoplastproplastidchromoplastid
Page: