Recent questions without answers

Enzyme-linked immunosorbent assay (ELISA) is used forquantifying antibody levels in blooddetermining the molecular weight of an antigenpurifying proteins from biological ...

Macrophages eliminate pathogenic bacteria upon activation byNK cellsbasophilsCD$4+$ T cellsplasma cells

If a protein contains four cysteine residues, the number of different ways they can simultaneously form two intra-molecular disulphide bonds is __________.

Secretory proteins synthesized by ER-associated ribosomes traverse throughmitochondriaperoxisomesthe Golgi apparatusthe nucleus

For $y=f(x)$, if $\dfrac{d^2y}{dx^2}=0$, $\dfrac{dy}{dx}=0$ at $x=0$, and $y=1$ at $x=1$, the value of $y$ at $x=2$ is __________

During protein synthesis, tRNAs are NOT involved incharginginitiationelongationtermination

In eukaryotes, cytokinesis is inhibited bycytochalasin Dvinblastinenocodazolecolchicine

A proto-oncogene is suspected to have undergone duplication in a certain type of cancer. Of the following techniques, which one would verify the gene duplication?Northern...

A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...

An enzymatic reaction exhibits Michaelis-Menten kinetics. For this reaction, on doubling the concentration of enzyme while maintaining $[S]>>[E_0]$both $K_m$ and $V_{\tex...

A $5$ liter chemostat is fed fresh medium at $0.2$ liters/minute having a substrate concentration of $25$ grams/liter. At steady state, the outgoing stream has substrate ...

The transcription factor $X$ binds a $10$ base pair DNA stretch. In the DNA of an organism, $X$ was found to bind at $20$ distinct sites. An analysis of these $20$ bindin...

A bacterium has a genome of size $6$ million base pairs. If the average rate of DNA synthesis is $1000$ base pairs/second, the time taken (in minutes) for replication of ...

At the transcription start site of a gene, any of the four nucleotides can occur with equal probability $p$. The Shannon Entropy $S$, given by $S= – \Sigma_{i=1}^4 p_i \l...

Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...

The distribution of marks scored by a large class in an exam can be represented as a normal distribution with mean $\mu$ and standard deviation $\sigma$. In a follow-up e...

The angle (in degrees) between the vectors $\overrightarrow{x}= \hat{i}-\hat{j}+2 \hat{k}$ and $\overrightarrow{y} = 2 \hat{i} – \hat{j}-1.5 \hat{k}$ is _________

Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...

The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below:Choose the correct combination.$P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{...

Match the organisms in $\text{Column I}$ with the characteristics in $\text{Column II}$:$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \textbf{Column II} \\ \hli...

Which one of the following amino acids has three ionizable groups?GlycineLeucineValineLysine

Consider an infinite number of cylinders. The first cylinder has a radius of $1$ meter and height of $1$ meter. The second one has a radius of $0.5$ meter and height of $...

The concentration (in micromolar) of NADH in a solution with $A_{340}=0.50$ is _________Given data: Path length $=1$ cm; Molar extinction coefficient of NADH $\varepsilon...

The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ...

Which one of the following organisms is responsible for crown gall disease in plants?$\textit{Xanthomonas campestris}$$\textit{Rhizobium etli}$$\textit{Agrobacterium tume...

The value of $c$ for which the following system of linear equations has an infinite number of solutions is ________ $$\begin{bmatrix}1 & 2 \\ 1 & 2 \end{bmatrix} \begin{b...

Match the plant hormones in $\textbf{Column I}$ with functions in $\textbf{Column II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \text{Column II} \\ \hline ...

For an $\textit{E.coli}$ culture in the exponential phase of growth, optical density (OD) at $540$ nm is $0.3$ at $2$ hours and $0.6$ at $4$ hours. Assuming that the meas...

An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...

The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$

A recombinant protein is to be expressed under the control of the lac promoter and operator in a strain $\textit{E.coli}$ having the genotype lacI$^+$ crp$^+$ . Even in t...

Shown below id a plasmid vector (P) and an insert (Q). The insert was cloned into the BamHI site of the vector. The recombinant plasmid was isolated and digested with Bam...

Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT

A pedigree of an inheritable disease is shown below.This inheritable disease is$X$-linked dominant$X$-linked recessive or Y-linkedonly $Y$-linkedonly $X$-linked recessive

If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________Given data: Atomic ...

For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________

Growth of a microbe in a test tube is modeled as $\dfrac{dX}{dt} = rX \bigg (1 – \dfrac{X}{K}\bigg )$, where, $X$ is the biomass, $r$ is the growth rate, and $K$ is the c...

A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...

The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...

EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...