Recent questions without answers

0 0 votes
0 0 answers
Enzyme-linked immunosorbent assay (ELISA) is used forquantifying antibody levels in blooddetermining the molecular weight of an antigenpurifying proteins from biological ...
0 0 votes
0 0 answers
Macrophages eliminate pathogenic bacteria upon activation byNK cellsbasophilsCD$4+$ T cellsplasma cells
0 0 votes
0 0 answers
If a protein contains four cysteine residues, the number of different ways they can simultaneously form two intra-molecular disulphide bonds is __________.
0 0 votes
0 0 answers
Secretory proteins synthesized by ER-associated ribosomes traverse throughmitochondriaperoxisomesthe Golgi apparatusthe nucleus
0 0 votes
0 0 answers
For $y=f(x)$, if $\dfrac{d^2y}{dx^2}=0$, $\dfrac{dy}{dx}=0$ at $x=0$, and $y=1$ at $x=1$, the value of $y$ at $x=2$ is __________
0 0 votes
0 0 answers
During protein synthesis, tRNAs are NOT involved incharginginitiationelongationtermination
0 0 votes
0 0 answers
In eukaryotes, cytokinesis is inhibited bycytochalasin Dvinblastinenocodazolecolchicine
0 0 votes
0 0 answers
A proto-oncogene is suspected to have undergone duplication in a certain type of cancer. Of the following techniques, which one would verify the gene duplication?Northern...
0 0 votes
0 0 answers
A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...
0 0 votes
0 0 answers
An enzymatic reaction exhibits Michaelis-Menten kinetics. For this reaction, on doubling the concentration of enzyme while maintaining $[S]>>[E_0]$both $K_m$ and $V_{\tex...
0 0 votes
0 0 answers
A $5$ liter chemostat is fed fresh medium at $0.2$ liters/minute having a substrate concentration of $25$ grams/liter. At steady state, the outgoing stream has substrate ...
0 0 votes
0 0 answers
The transcription factor $X$ binds a $10$ base pair DNA stretch. In the DNA of an organism, $X$ was found to bind at $20$ distinct sites. An analysis of these $20$ bindin...
0 0 votes
0 0 answers
A bacterium has a genome of size $6$ million base pairs. If the average rate of DNA synthesis is $1000$ base pairs/second, the time taken (in minutes) for replication of ...
0 0 votes
0 0 answers
At the transcription start site of a gene, any of the four nucleotides can occur with equal probability $p$. The Shannon Entropy $S$, given by $S= – \Sigma_{i=1}^4 p_i \l...
0 0 votes
0 0 answers
Which one of the following graphs represents the kinetics of protein precipitation by addition of ammonium sulphate? On the $Y$-axis, [Protein] represents the concentrati...
0 0 votes
0 0 answers
The distribution of marks scored by a large class in an exam can be represented as a normal distribution with mean $\mu$ and standard deviation $\sigma$. In a follow-up e...
0 0 votes
0 0 answers
The angle (in degrees) between the vectors $\overrightarrow{x}= \hat{i}-\hat{j}+2 \hat{k}$ and $\overrightarrow{y} = 2 \hat{i} – \hat{j}-1.5 \hat{k}$ is _________
0 0 votes
0 0 answers
Match the proteins in $\textbf{Group I}$ with cellular processes in $\textbf{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} & & \text{Group II} \\ \hline P...
0 0 votes
0 0 answers
The circular dichroism spectra of three proteins $P$, $Q$, and $R$ are given below:Choose the correct combination.$P: \alpha- \text{helix}, Q: \beta- \text{sheet}, \text{...
0 0 votes
0 0 answers
Match the organisms in $\text{Column I}$ with the characteristics in $\text{Column II}$:$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \textbf{Column II} \\ \hli...
0 0 votes
0 0 answers
Which one of the following amino acids has three ionizable groups?GlycineLeucineValineLysine
0 0 votes
0 0 answers
Consider an infinite number of cylinders. The first cylinder has a radius of $1$ meter and height of $1$ meter. The second one has a radius of $0.5$ meter and height of $...
0 0 votes
0 0 answers
The concentration (in micromolar) of NADH in a solution with $A_{340}=0.50$ is _________Given data: Path length $=1$ cm; Molar extinction coefficient of NADH $\varepsilon...
0 0 votes
0 0 answers
The specific activity of an enzyme in a crude extract of $\textit{E.coli}$ is $9.5$ units/mg of protein. The specific activity increased to $68$ units/mg of protein upon ...
0 0 votes
0 0 answers
Which one of the following organisms is responsible for crown gall disease in plants?$\textit{Xanthomonas campestris}$$\textit{Rhizobium etli}$$\textit{Agrobacterium tume...
0 0 votes
0 0 answers
The value of $c$ for which the following system of linear equations has an infinite number of solutions is ________ $$\begin{bmatrix}1 & 2 \\ 1 & 2 \end{bmatrix} \begin{b...
0 0 votes
0 0 answers
Match the plant hormones in $\textbf{Column I}$ with functions in $\textbf{Column II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Column I} && \text{Column II} \\ \hline ...
0 0 votes
0 0 answers
For an $\textit{E.coli}$ culture in the exponential phase of growth, optical density (OD) at $540$ nm is $0.3$ at $2$ hours and $0.6$ at $4$ hours. Assuming that the meas...
0 0 votes
0 0 answers
An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...
0 0 votes
0 0 answers
The genome is diploid at the end of which phases of a human mitotic cell cycle?$\text{G2 & S}$$\text{G1 & M}$$\text{M & S}$$\text{G1 & G2}$
0 0 votes
0 0 answers
A recombinant protein is to be expressed under the control of the lac promoter and operator in a strain $\textit{E.coli}$ having the genotype lacI$^+$ crp$^+$ . Even in t...
0 0 votes
0 0 answers
Shown below id a plasmid vector (P) and an insert (Q). The insert was cloned into the BamHI site of the vector. The recombinant plasmid was isolated and digested with Bam...
0 0 votes
0 0 answers
Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT
0 0 votes
0 0 answers
A pedigree of an inheritable disease is shown below.This inheritable disease is$X$-linked dominant$X$-linked recessive or Y-linkedonly $Y$-linkedonly $X$-linked recessive
0 0 votes
0 0 answers
If the chemical composition of proteins in an organism is $CH_{1.5}O_{0.3}N_{0.3}S_{0.004}$, the mass percentage of carbon in the protein is __________Given data: Atomic ...
0 0 votes
0 0 answers
For the probability density $P(x) = 0.5e^{-0.5x}$, the integral $\displaystyle \int_0^{\infty}P(x)dx =$ __________
0 0 votes
0 0 answers
Growth of a microbe in a test tube is modeled as $\dfrac{dX}{dt} = rX \bigg (1 – \dfrac{X}{K}\bigg )$, where, $X$ is the biomass, $r$ is the growth rate, and $K$ is the c...
0 0 votes
0 0 answers
A zero-order liquid phase reaction $A \xrightarrow{k} B$ is being carried out in a batch reactor with $k=10^{-3}$ mol/min. If the starting concentration of $A$ is $0.1$ m...
0 0 votes
0 0 answers
The interaction energy $E$ between two spherical particles is plotted as a function of the distance $(r)$ between them. When $r<a$, where $a$ is a constant, the net force...
0 0 votes
0 0 answers
EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...