Questions without answers in Molecular tools

​​​​Which of the following methods is/are used for identifying histone modifications?ChIP-seqMass spectrometryImmunofluorescencePatch-clamp electrophysiology

Which one of the following is the basic principle of Sanger's DNA sequencing method?Chain termination by incorporation of dideoxynucleotidesChain elongation by incorporat...

Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

In hybridoma technology, which one of the following enzymes is absent in the myeloma cells that are used for monoclonal antibody production?Hypoxanthine-guanine phosphori...

Which of the following methods are used for detection of DNA and RNA, respectively?Southern and Northern blotting Southern and Western blottingNorthern and Southern blott...

Direct DNA transfer method(s) used for plant genetic engineering is(are)microparticle bombardmentelectroporationpolyethylene glycol treatmentAgrobacterium-mediated transf...

The recognition sequences of four Type-II restriction enzymes $\text{(RE)}$ are given below. The symbol $(\downarrow)$ indicates the cleavage site. Identify the $\text{RE...

Among individuals in a human population, minor variations exist in nucleotide sequences of chromosomes. These variations can lead to gain or loss of sites for specific re...

Which one of the following techniques/tools is $\text{NOT}$ used for inserting a foreign gene into a cell?$\text{DNA}$ microarrayElectroporationGene gunMicroinjection

The enzyme which adds phosphate group to the free $5’$ terminus of a $\text{DNA}$ sequence isadenosine kinasealkaline phosphatasepolynucleotide kinaseterminal deoxynucleo...

For site-directed mutagenesis, which one of the following restriction enzymes is used to digest methylated $DNA$?$KpnI$$DpnI$$XhoI$$MluI$

Which of the following factors affect the fidelity of $DNA$ polymerase in polymerase chain reaction?$Mg^{2+}$ concentration$pH$Annealing temperature$P$ and $Q$ only$P$ an...

A vector derived from which one of the following viruses is used for high - frequency genomic integration of a transgene in animal cells?AdenoviruAdeno-associated virusLe...

Which one of the following statements about $Agrobacterium \;Ti\; plasmid$ is $CORRECT$?$Vir$ genes are located within the $T-DNA$ segmentPhytohormone biosynthesis genes ...

The Bt toxin gene from $Bacillus\; thuringiensis$ used to generate genetically modified crops is$cry$$cro$$cdc$$cre$

Which one of the following techniques can be used to compare the expression of a large number of genes in two biological samples in a single experiment?Polymerase chain r...

Which one of the following is NOT a therapeutic agent based on nucleic acid for the treatment of genetic disorders?Antisense oligonucleotideRibozymeAptamerAvidin

A polymerase chain reaction (PCR) was set up with the following reagents: DNA template, Taq polymerase, buffer, dNTPs, and Mg$^{2+}$. Which one of the following is missin...

Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT

EcoRI restriction sites on a $10$ kb DNA fragment are shown below.Upon partial digestion, what are the lengths (in kb) of all the possible DNA fragments obtained?$2,3,4,5...

In DNA sequencing reactions using the chain termination method, the ratio of ddNTPs to dNTPs should be$0$$< 1$$1$$>1$

Choose the appropriate pair of primers to amplify the following DNA fragment by the polymerase chain reaction (PCR).$$\textrm{5’ – GACCTGTGG- – – – – – – – – – – – – – – ...

A linear double stranded DNA of length $8$ kbp has three restriction sites. Each of these can either be a $\textit{Bam}\text{HI}$ or a $\textit{Hae}III$ site. The DNA was...

The plasmid DNA was subjected to restriction digestion using the enzyme $\textit{EcoRI}$ and analysed on an agarose gel. Assuming digestion has worked (the enzyme was act...

Protein-DNA interactions $\text{in vivo}$ can be studied bygel shift assaySouthern hybridizationchromatin immunoprecipitation assayfluorescence $\text{in situ}$ hybridiza...

Which one of the following is NOT a protoplast fusion inducing agent?Inactivated Sendai virus$Ca^{2+}$ at alkaline pHPolyethylene glycolColchicine