1 1 vote Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE? $5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$ It contains nine codons in the reading frame It contains ten codons in the reading frame It codes for eight amino acids It codes for nine amino acids Molecular Biology and Genetics: gatebt-2024 molecular-biology-and-genetics biochemistry + – admin 3.0k points answer comment Share Follow 0 reply Please log in or register to add a comment.