• recategorized by

Please log in or register to answer this question.

Answer:

Related questions

0 0 votes
0 0 answers
admin asked Mar 25, 2024
Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...
1 1 vote
0 0 answers
admin asked Mar 25, 2024
$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule.$\text{C-N}$ $\text{N-O}$$\text{S-C}$$\text{S-S...
0 0 votes
0 0 answers
admin asked Mar 25, 2024
An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$carbonnitrogenoxygenphosphorous
1 1 vote
0 0 answers
admin asked Mar 25, 2024
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...
0 0 votes
0 0 answers
admin asked Mar 25, 2024
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...