Recent questions tagged analytical-aptitude

Which of the following are TRUE for Treponema pallidum?It is the causative agent of syphilisIt is a spirocheteIt is a non-motile bacteriumIt is generally susceptible to p...

In dead-end filtration, rate of filtration isdirectly proportional to the square root of pressure drop across the filter mediuminversely proportional to the pressure drop...

Decimal reduction time of bacterial spores is $23$ min at $121 ^\circ C$ and the death kinetics follow first order. One liter medium containing $10^5$ spores per $mL$ was...

An enzyme is immobilized on the surface of a non-porous spherical particle of $2$ mm diameter. The immobilized enzyme is suspended in a solution having bulk substrate con...

An immunocompetent person becomes infected with a pathogenic strain of bacteria. Which one of the following graphs correctly depicts bacterial load in this person over ti...

Which one of the following CANNOT be a recognition sequence for a Type II restriction enzyme?GAATTCAGCTGCGGCCGCATGCCT

Some tables are shelves. Some shelves are chairs. All chairs are benches. Which of the following conclusions can be deduced from the preceding sentences?At least one benc...

S, T, U, V, W, X, Y, and Z are seated around a circular table. T’s neighbours are Y and V. Z is seated third to the left of T and second to the right of S. U’s neighbour ...

Fill in the missing value

Match the drugs in $\text{Group I}$ with their mechanism of action in $\text{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} && \textbf{Group II} \\ \hline ...

In a group of four children, Som is younger to Riaz. Shiv is elder to Ansu. Ansu is youngest in the group. Which of the following statements is/are required to find the e...

X is $1$ km northeast of Y. Y is $1$ km southeast of Z. W is $1$ km west of Z. P is $1$ km south of W. Q is $1$ km east of P. What is the distance between X and Q in km?$...

Cholera toxin increases $cAMP$ levels bymodifying $G_i$ proteinmodifying $G_s$ proteinbinding to adenylate cyclaseactivating $cAMP$ phosphodiesterase

All professors are researchers.Some scientists are professors.Which of the given conclusions is logically valid and is inferred from the above arguments:All scientists ar...

Match the herbicides in $\text{Group I}$ with the target enzymes in $\text{Group II}$ $\begin{array}{|l|l|l|l|} \hline & \text{Group I} && \text{Group II} \\ \hline P. & ...

The catalytic efficiency for an enzyme is defined as$K_{cat}$$\frac{V_{max}}{K_{cat}}$$\frac{k_{cat}}{K_m}$$\frac{K_{cat}}{V_{max}}$

Answer the question based on the information given below:The purification data for an enzyme is given below:$\begin{array}{|l|l|l|l|l|l|} \hline & \text{Step} & \text{Vol...

Match the vitamins in $\text{Group I}$ with the processes/reactions in $\text{Group II}$$\begin{array}{|l|l|l|l|} \hline & \text{Group I} && \text{Group II} \\ \hline P. ...

Match the high energy compounds in $\text{Group I}$ with the biosynhetic pathways for the molecules in $\text{Group II}$.$\begin{array}{|l|l|l|l|} \hline & \text{Group I...

Match the entries in $\text{Group I}$ with the methods of sterilization in $\text{Group II}$$\begin{array}{|l|l|l|l|} \hline & \textbf{Group I} && \text{Group II} \\ \h...

Match the downstream processes in $\text{Group I}$ with the products in $\text{Group II}$.$\begin{array}{|C|l|C|l|} \hline& \textbf{Group I} & {} & \textbf{Group II} \\\h...

Match the entries in $\text{Group I}$ with the process parameters in $\text{Group II}$.$\begin{array}{|C|l|C|l|} \hline &\textbf{Group I} & {} & \text{Group II} \\\hline ...

Determine the correctness or otherwise of the following $Assertion$ (a) and $Reason$ (r).$Assertion:$ Plants convert fatty' acids into glucose. $Reason:$ Plants have ...

Match the products in $\text{Group I}$ with the applications in $\text{Group II}$.$\begin{array}{|C|l|C|l|} \hline &\textbf{Group I} & {} &\textbf{Group II} \\\hline P. ...

Match the entries in $\textbf{Group I}$ with those in $\textbf{Group II}$.$\begin{array}{|c|l|c|l|}\hline &\textbf{Group I} & {} & \textbf{Group II} \\\hline P. & \text{M...

A protein is phosphorylated at a serine residue. A phosphomimic mutant of the protein can be generated by substituting that serine withglycinealanineaspartatethreonine

The basis for blue-white screening with $pUC$ vectors isintraallelic complementationintergenic complementationintragenic suppressionextragenic suppression

Which of the following are true about bacterial superoxide dismutase?Present in obligate aerobesPresent in facultative anaerobesPresent in aerotolerant anaerobesAbsent in...

Which of the following components constitute a molecular mechanics force field?Bond stretchingBond angle bendingTorsional bond rotationNon-bonded interactionsP and Q only...