Recent questions

Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

Match the item in Column I with the corresponding technique in Column II.\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Blue laser}...

Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...

The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution.convergentdivergentneutralparallel

Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme?It binds to the substrate binding site of the enzyme onlyIt binds to the en...

Which of the following plant-based secondary metabolites belong(s) to the class of alkaloids? Ajmalicine $\left(\mathrm{C}_{21} \mathrm{H}_{24} \mathrm{~N}_2 \mathrm{O}_3...

Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...

Which of the following is/are considered as biotic elicitor(s) in plant cell culture?CellulaseChitinChitosanMercuric chloride

Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle?Initiation of cell plate formationIncomplete DNA replicationC...

Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...

Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...

Under complete cell washout condition in a chemostat with sterile feed, which of the following statements is/are correct?Biomass concentration in the reactor is maximumS...

Aspergillus niger is grown in a $10,000$ L stirred batch bioreactor under aerated conditions to produce citric acid. At steady state oxygen transfer conditions, the speci...

Ethanol is produced in a $10,000$ L stirred bioreactor using an impeller of diameter $1 \mathrm{~m}$. The density and viscosity of fermentation broth are $1000 \mathrm{~k...

The free energy change of ATP hydrolysis at $25^{\circ} \mathrm{C}$ is $-32.2 \mathrm{~kJ} \mathrm{~mol}^{-1}$. The free energy change for hydrolysis of $\alpha$-glycerop...

A fermentor is filled with medium at a rate of $1 \mathrm{~L} \mathrm{~min}^{-1}$. A leak develops at the bottom of the fermentor when the medium in the fermentor reaches...

Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ prototype stirred tank reactor. The model-type and prototype have the ...

The value of the limit $\lim _{x \rightarrow \infty} \frac{x}{2} \ln \left(1+\frac{2024}{x}\right)$ is $\_\_\_\_\_\_\_\_$.

Let $y(x)=x^2 \ln x$ for $x>0$, be a solution of $x^2 \frac{d^2 y}{d x^2}+4 y=\alpha x \frac{d y}{d x}$. Then the value of $\alpha$ is $\_\_\_\_\_\_\_\_\_$.

The absolute relative error in evaluating the integral $\int_0^1 x^2 d x$ by the trapezoidal rule with the step size $0.25$ is $\%$ $\_\_\_\_\_\_\_\_$ (rounded off to $2$...

If ' $\rightarrow$ ' denotes increasing order of intensity, then the meaning of the words $[$ dry $\rightarrow$ arid $\rightarrow$ parched] is analogous to [diet $\righta...

In the given text, the blanks are numbered (i)-(iv). Select the best match for all the blanks.Steve was advised to keep his head __(i)_ before heading _(ii)__ to bat; for...

A rectangular paper sheet of dimensions $54 \mathrm{~cm} \times 4 \mathrm{~cm}$ is taken. The two longer edges of the sheet are joined together to create a cylindrical tu...

The pie chart presents the percentage contribution of different macronutrients to a typical $2,000$ $\mathrm{kcal}$ diet of a person.The typical energy density $(\mathrm{...

A rectangular paper of $20 \mathrm{~cm} \times 8 \mathrm{~cm}$ is folded $3$ times. Each fold is made along the line of symmetry, which is perpendicular to its long edge....

The least number of squares to be added in the figure to make AB a line of symmetry is$6$$4$ $5$ $7$

A batch cultivation of E. coli follows zeroth order Monod’s growth kinetics. The cell growth is terminated when the residual dissolved oxygen concentration attains 10% of...