#161
0 0 votes
0 0 answers
Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...
#162
0 0 votes
0 0 answers
Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...
#163
0 0 votes
0 0 answers
Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...
#164
0 0 votes
0 0 answers
Match the item in Column I with the corresponding technique in Column II.\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Blue laser}...
#165
0 0 votes
0 0 answers
Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...
#166
0 0 votes
0 0 answers
The evolution of wings in bats and insects is an example of $\_\_\_\_\_\_\_$ evolution.convergentdivergentneutralparallel
#167
0 0 votes
0 0 answers
Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme?It binds to the substrate binding site of the enzyme onlyIt binds to the en...
#168
0 0 votes
0 0 answers
Which of the following plant-based secondary metabolites belong(s) to the class of alkaloids? Ajmalicine $\left(\mathrm{C}_{21} \mathrm{H}_{24} \mathrm{~N}_2 \mathrm{O}_3...
#169
0 0 votes
0 0 answers
Which of the following features help(s) in distinguishing alleles using restriction fragment length polymorphism (RFLP)?Differences in the number of recognition sites for...
#170
1 1 vote
0 0 answers
Which of the following is/are considered as biotic elicitor(s) in plant cell culture?CellulaseChitinChitosanMercuric chloride
#171
0 0 votes
0 0 answers
Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle?Initiation of cell plate formationIncomplete DNA replicationC...
#172
0 0 votes
0 0 answers
Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...
#173
1 1 vote
0 0 answers
Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...
#174
0 0 votes
0 0 answers
Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...
#175
–1 –1 vote
0 0 answers
Which of the following factors can affect the growth of a microbial culture in a batch cultivation process?$\mathrm{pH}$ of the medium Osmolarity of the mediumSubstrate c...
#176
0 0 votes
0 0 answers
Under complete cell washout condition in a chemostat with sterile feed, which of the following statements is/are correct?Biomass concentration in the reactor is maximumS...
#177
0 0 votes
1 1 answer
Fermentation medium is cooled from $121^{\circ} \mathrm{C}$ to $30{ }^{\circ} \mathrm{C}$ in a double pipe heat exchanger. If cold water is flowing in the counter-current...
#178
0 0 votes
0 0 answers
Aspergillus niger is grown in a $10,000$ L stirred batch bioreactor under aerated conditions to produce citric acid. At steady state oxygen transfer conditions, the speci...
#179
0 0 votes
0 0 answers
Ethanol is produced in a $10,000$ L stirred bioreactor using an impeller of diameter $1 \mathrm{~m}$. The density and viscosity of fermentation broth are $1000 \mathrm{~k...
#180
0 0 votes
0 0 answers
The free energy change of ATP hydrolysis at $25^{\circ} \mathrm{C}$ is $-32.2 \mathrm{~kJ} \mathrm{~mol}^{-1}$. The free energy change for hydrolysis of $\alpha$-glycerop...
#181
0 0 votes
1 1 answer
E. coli is inoculated in a shake flask containing nutrient rich medium. The initial number of viable cells in the medium is $10^2$. After few hours, the number of viable ...
#182
0 0 votes
0 0 answers
A fermentor is filled with medium at a rate of $1 \mathrm{~L} \mathrm{~min}^{-1}$. A leak develops at the bottom of the fermentor when the medium in the fermentor reaches...
#183
0 0 votes
1 1 answer
A fed batch process is running at quasi-steady state with respect to substrate and biomass concentration. At $2 \mathrm{~h}$, the culture volume is $500 \mathrm{~L}$ with...
#184
0 0 votes
0 0 answers
Consider scale-up of fungal fermentation from a $20 \mathrm{~L}$ model-type to $20,000 \mathrm{~L}$ prototype stirred tank reactor. The model-type and prototype have the ...
#185
0 0 votes
1 1 answer
If $\vec{v}=\left(\begin{array}{l}2 \\ 2 \\ 2\end{array}\right)$ is an eigenvector of the matrix $\left(\begin{array}{lll}1 & 2 & 3 \\ 1 & 2 & 3 \\ 1 & 2 & 3\end{array}\r...
#186
0 0 votes
0 0 answers
The value of the limit $\lim _{x \rightarrow \infty} \frac{x}{2} \ln \left(1+\frac{2024}{x}\right)$ is $\_\_\_\_\_\_\_\_$.
#187
0 0 votes
0 0 answers
Let $y(x)=x^2 \ln x$ for $x>0$, be a solution of $x^2 \frac{d^2 y}{d x^2}+4 y=\alpha x \frac{d y}{d x}$. Then the value of $\alpha$ is $\_\_\_\_\_\_\_\_\_$.
#188
0 0 votes
0 0 answers
The absolute relative error in evaluating the integral $\int_0^1 x^2 d x$ by the trapezoidal rule with the step size $0.25$ is $\%$ $\_\_\_\_\_\_\_\_$ (rounded off to $2$...
#189
0 0 votes
0 0 answers
If ' $\rightarrow$ ' denotes increasing order of intensity, then the meaning of the words $[$ dry $\rightarrow$ arid $\rightarrow$ parched] is analogous to [diet $\righta...
#190
2 2 votes
1 1 answer
If two distinct non-zero real variables $x$ and $y$ are such that $(x+y)$ is proportional to $(x-y)$ then the value of $\frac{x}{y}$depends on $x y$depends only on $x$ an...
#191
1 1 vote
1 1 answer
Consider the following sample of numbers:\[9,18,11,14,15,17,10,69,11,13\]The median of the sample is$13.5$$14$$11$$18.7$
#192
2 2 votes
1 1 answer
The number of coins of ₹ $1$, ₹ $5$, and ₹ $10$ denominations that a person has are in the ratio $5: 3: 13$. Of the total amount, the percentage of money in ₹ $5$ coins i...
#193
3 3 votes
2 answers 2 answers
For positive non-zero real variables $p$ and $q$, if\[\log \left(p^{2}+q^{2}\right)=\log p+\log q+2 \log 3,\]then, the value of $\frac{p^{4}+q^{4}}{p^{2} q^{2}}$ is$79$$8...
#194
0 0 votes
0 0 answers
In the given text, the blanks are numbered (i)-(iv). Select the best match for all the blanks.Steve was advised to keep his head __(i)_ before heading _(ii)__ to bat; for...
#195
0 0 votes
0 0 answers
A rectangular paper sheet of dimensions $54 \mathrm{~cm} \times 4 \mathrm{~cm}$ is taken. The two longer edges of the sheet are joined together to create a cylindrical tu...
#196
0 0 votes
0 0 answers
The pie chart presents the percentage contribution of different macronutrients to a typical $2,000$ $\mathrm{kcal}$ diet of a person.The typical energy density $(\mathrm{...
#197
0 0 votes
0 0 answers
A rectangular paper of $20 \mathrm{~cm} \times 8 \mathrm{~cm}$ is folded $3$ times. Each fold is made along the line of symmetry, which is perpendicular to its long edge....
#198
0 0 votes
0 0 answers
The least number of squares to be added in the figure to make AB a line of symmetry is$6$$4$ $5$ $7$
#199
0 0 votes
0 0 answers
A batch cultivation of E. coli follows zeroth order Monod’s growth kinetics. The cell growth is terminated when the residual dissolved oxygen concentration attains 10% of...
#200
–1 –1 vote
2 2 answers
"You are delaying the completion of the task. Send ____________ contributions at the earliest."you areyouryou'reyore