Recent questions in General Biology

​​​​Correctly match the Coenzyme with its respective involvement in a specific Reaction type.\begin{array}{|l|l|}\hline \textbf{Coenzyme } & \textbf{Reaction type} \\\hli...

​​​​Correctly match the following Bioinformatic tool/Database with its respective Utility.\begin{array}{|l|l|}\hline \textbf{Bioinformatic tool/Database} & \textbf{Utilit...

​​​​​Which of the following statements is/are true regarding the effect of the concentration of metabolic intermediates on glycolysis in erythrocytes?Increased AMP levels...

​​​​Which of the following statements about initiation of DNA replication in eukaryotes is/are true?DNA replication is initiated at the origin of replication licensed by ...

​​​​Which of the following proteins is/are involved in intraflagellar transport?MicrotubulesMyosinActinKinesin

​​​​Which of the following statements is/are true about telomerase?Telomerase has $5^{\prime}-3^{\prime}$ DNA-dependent DNA polymerisation activityTelomerase has $5^{\pri...

​​​​​Which of the following amino acids contain(s) two chiral carbons?L-LeucineL-ThreonineL-IsoleucineL-Asparagine

The percentage of light that would pass through a sample with an absorbance of $2$ would be $\_\_\_\_\_$ $\%$ .(Round off to the nearest integer)

An NMR spectrometer operating at proton resonance frequency $(v)$ of $1 \: \mathrm{GHz}$ will have a magnetic field strength of $\_\_\_\_$ Tesla (T).The gyromagnetic rati...

For the coupled reactions given below\[\begin{array}{ll}\text { Glucose 6-phosphate }+\mathrm{H}_{2} \mathrm{O} \rightarrow \text { Glucose }+\mathrm{Pi} & \text { (React...

In adsorption chromatography, the adsorption of uncharged solute molecules onto a silica-based stationary phase is by $\_\_\_\_\_\_\_$.covalent bondselectrostatic interac...

Co-translational translocation of proteins is observed in $\_\_\_\_\_\_\_$.endoplasmic reticulumGolgi complexmitochondriaperoxisomes

$2$-mercaptoethanol breaks the $\_\_\_\_\_\_\_$ covalent bond between light and heavy chains of an immunoglobulin molecule.$\text{C-N}$ $\text{N-O}$$\text{S-C}$$\text{S-S...

A cultured skin fibroblast cell of a goat ' $\mathrm{P}$ ' was fused with an enucleated ovum of a goat ' $\mathrm{Q}$ '. The resultant activated early embryo was then tra...

An element that is present in a nucleotide but not in a nucleoside is $\_\_\_\_\_\_\_$carbonnitrogenoxygenphosphorous

Krebs $\text{(TCA)}$ cycle is $\_\_\_\_\_\_$ pathway.only an anaboliconly a catabolic an amphibolica pyogenic

If a denatured protein of human origin is injected into a rabbit, antibodies generated will recognize the $\_\_\_\_\_\_$ structure of the protein.primarysecondarytertiary...

All pseudogenes DO NOT code for a $\_\_\_\_\_\_\_$.protein with original functionprotein with altered functionRNA with coding sequenceRNA with regulatory function

Match the industrial enzyme (Column I) with its application (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Lipase} & 1. \...

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

Match the item in Column I with the corresponding technique in Column II.\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Blue laser}...

Match the genetic disorder (Column I) with its molecular basis (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Sickle-cell a...

Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme?It binds to the substrate binding site of the enzyme onlyIt binds to the en...

Under which of the following conditions, a mammalian somatic cell fails to undergo mitosis during cell cycle?Initiation of cell plate formationIncomplete DNA replicationC...

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...

The pie chart presents the percentage contribution of different macronutrients to a typical $2,000$ $\mathrm{kcal}$ diet of a person.The typical energy density $(\mathrm{...

Determine the correctness or otherwise of the following Assertion $[\text{a}]$ and the Reason $[\mathrm{r}]$.Assertion $[\mathrm{a}]$: In multicellular organisms, cells o...