Recent questions tagged biochemistry

Match the enzyme (Column I) with its corresponding function (Column II).\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Primase} & 1...

Match the item (Column I) with its corresponding use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Glutamine} & 1. \text{D...

Match the chemical (Column I) with its use (Column II).\begin{array}{|c|c|c|}\hline \text{Column I} & \text{Column II} \\\hline \text{P. Diethylpyrocarbonate} & 1. \text{...

Match the item in Column I with the corresponding technique in Column II.\begin{array}{|c|c|c|}\hline & \text{Column I} & \text{Column II} \\\hline & \text{P. Blue laser}...

Which of the following statements is/are correct about an uncompetitive inhibitor of an enzyme?It binds to the substrate binding site of the enzyme onlyIt binds to the en...

Which of the following plant-based secondary metabolites belong(s) to the class of alkaloids? Ajmalicine $\left(\mathrm{C}_{21} \mathrm{H}_{24} \mathrm{~N}_2 \mathrm{O}_3...

Which of the following is/are synthetic auxin(s) that does/do NOT occur naturally?$2,4$-Dichlorophenoxyacetic acid Indole-$3$-acetic acidIndole-$3$-butyric acid$1$-Naphth...

Which of the following statements regarding the below mentioned mRNA sequence is/are TRUE?$5'-\text{UGAUGAGCCUUAACCGGGAACGAAUUUAAG}-3'$It contains nine codons in the read...

Which of the following conditions induce(s) the expression of $\beta$-galactosidase gene in the lac operon?Absence of glucoseAbsence of lactosePresence of glucosePresence...

The free energy change of ATP hydrolysis at $25^{\circ} \mathrm{C}$ is $-32.2 \mathrm{~kJ} \mathrm{~mol}^{-1}$. The free energy change for hydrolysis of $\alpha$-glycerop...

The pie chart presents the percentage contribution of different macronutrients to a typical $2,000$ $\mathrm{kcal}$ diet of a person.The typical energy density $(\mathrm{...

Which one of the following statements is TRUE about leghemoglobin?It binds oxygen to protect nitrogenaseIt binds hemoglobin to protect oxygenaseIt binds oxygen to protect...

Intracellular proteins are targeted for proteolytic degradation in proteasomes upon conjugation with ubiquitinintegrinpeptidasecalreticulin

Which of the following statement(s) is(are) TRUE about fluoroquinolone drugs?They contain quinolone ring(s)They inhibit RNA polymeraseThey bind to bacterial topoisomerase...

Temperature of a reaction with an activation energy value of $15 \mathrm{kcal} \mathrm{mol}^{-1}$ is increased from $300 \mathrm{~K}$ to $310 \mathrm{~K}$. If the value o...

E. coli cultivated at $298 \mathrm{~K}$ uptakes an uncharged compound (A) by passive diffusion. The intracellular and extracellular concentrations of $\mathrm{A}$ are $0...

The number of different possible ways of forming five intramolecular disulfide bonds with ten cysteine residues of a protein is ______________.

An enzyme (E) catalyzes the biochemical reaction $A \rightarrow B$ with $k_{c a t}$ equal to $500 s^{-1}$. If the initial reaction velocity $\left(V_{0}\right)$ is $10 \m...

DNA sample collected from an unidentified bacterial species $(Y)$ contains $13 \%$ of adenine. The $G+C$ content (in percentage) of $Y$ is ____________.

If $1000 \mathrm{bp}$ of a double-helical DNA weighs $1 \times 10^{-18} \mathrm{gm}$ and distance between two $\mathrm{bp}$ is $0.34 \mathrm{~nm}$, the total amount of DN...

A protein has three identical sites arranged at the vertices of an equilateral triangle. If one site is filled with a dye (donor), the measured quantum yield $\left(\phi_...

A dNTP master-mix is prepared by combining $40 \mu L$ of each $20 \mathrm{mM}$ dNTP stock (dATP, dCTP, dGTP and dTTP). $4 \mu L$ of this dNTP master-mix is added to a PCR...

Which of the following statements about reversible enzyme inhibitors are $\text{CORRECT}?$Uncompetitive inhibitors bind only to the enzyme-substrate complexNon-competitiv...

The recognition sequences of four Type-II restriction enzymes $\text{(RE)}$ are given below. The symbol $(\downarrow)$ indicates the cleavage site. Identify the $\text{RE...

Match the media component used in mammalian cell culture (Column I) with its respective role (Column II).$$\begin{array} {lll} \textbf{Column I} & & \textbf{Column II} \\...

Match the stationary phase (Column I) with its corresponding chromatography technique (Column II).$$\begin{array} {lll} \textbf{Column I} & & \textbf{Column II} \\ \text{...

Which of the following are CORRECT about protein structure?Secondary structure is formed by a repeating pattern of interactions among the polypeptide backbone atomsTertia...

The enzymes involved in ubiquitinylation of cell-cycle proteins are$\text{E}_{1}$ and $\text{E}_{2}$ Only$\text{E}_{1}$ and $\text{E}_{3}$ Only$\text{E}_{1}$ and $\text{E...

Which of the following spectroscopic technique(s) can be used to identify all the functional groups of an antibiotic contaminant in food?InfraredCircular dichroismNuclear...

Adenine can undergo a spontaneous change to hypoxanthine in a cell, leading to a $\text{DNA}$ base pair mismatch. The $\text{CORRECT}$ combination of enzymes that are inv...

Which of the following is(are) $\text{COMMON}$ feature(s) for both aerobic and anaerobic bacterial cultures?Glycolysis$\text{NAD}^{+}$ is the oxidising agentOxidative pho...

Which of the following plot(s) is(are) $\text{CORRECT}$ for an enzyme that obeys Michaelis-Menten kinetics, assuming $[S] \ll K_{m}$?$[S]$ is the concentration of the sub...

Liquid-phase mass transfer coefficient $(k_{L})$ is measured in a stirred tank vessel using steady-state method by sparging air. Oxygen uptake by the microorganism is mea...

Consider the growth of $\textit{S. cerevisiae}$ under aerobic condition in a bioreactor and the specific growth rate of yeast is $0.5\; \text{h}^{-1}.$ The overall reacti...

The enzyme that transcribes the eukaryotic genes encoding precursor ribosomal $\text{RNAs}\; (\text{pre-RNAs}$) of $28S$, $18S$ and $5.8S$ $\text{rRNA}$s is$\text{RNA}$ p...